Transcript asmbl_80947

Sequence
Transcript Sequence for observation asmbl_80947 of TGE0004263:
CTAGGGAATGACAGGCACCTCCACAGGCAGGCTGCATCCACCTCAGCTGAGGTGTCGTCATTGGCTGCCTATTAGAAAAACCTACAGGACAATGCATACCACCGACTGCCGACTGTAAACATAGGGGATGTGTGTTCACTTAGCACGGACTTCTGGGAGGGGCTAAGGAAGGGCGGTCTGGAGTTTTATTGAATAGAGCAGTGTGTATGAGGCTGCCTGCCTGCCTGCCCTCTTGCTGTGCTCCTGCTTAAAGAAATCAGTCCTTCCTGTCCGACTTAGTCCTAGGAAGAAGTTTCAGCCTACGAGATATCATTAAAACATTCCAAGATCATCCAGTCGAATTCTACAGGGATTGGCGATCAACCGGAACACTCTGACGTGGATATCTGATTGCTTACCTGTCCAGACATCATCTGGTCTCCTTAAACCTGAAACCACACCATGGATGACTTTGAACGTCGCAGAGAACTTAGGAGGCAAAAACGGGAAGAGATGCGCCTGGAAGCAGAAAGAATCGCCTACCAGAGAAACGACGACGATGAGGAAGAGGCCGCCCGGGAACGGCGCCGCCGAGCCCGACAGGAAAGGCTGCGGCAGAAGCAAGAGGAAGAATCTTTTGGGCAGGTGACTGACCAGGTGGAGGTTAACGCCCAGAACAGTGTGCCTGACGAGGTCAAGACAACCACGGCGAACACTCAGGTGGAGGGCGACGACGAGGCCGCGTTCCTGGAGCGCCTGGCTCGGCGGGAGGAGAGACGCCAAAAACGCCTCCAAGAAGCTCTGGAGCGGCAGAAGGAGTTCGACCCCACAATAACGGATGCAAGTTTGTCGCTACCAAGCAGAAGAACGCAAAACGACACAGAAGAAAACGAACATGCAGAGAAGGAAGAAATCAGTGAAAGTCGCCAAGAAAGATACGAGATAGAGGAAACAGAAATAGTCACGAAGTCCTACCAGAAGAACGACTGGAGGGTTGCTGAAGAGAACAAGAAAGACGAAAAAGAAAAGGAGGGAGAGGAAGAAGAGAAGCCAAAGCCAGGGAGCATCAAGGAAAATCAGATCAAAGATGAGAAGATGAAAAAGGACAAAGAGCCCAGGGAAGATGTTAAGAGCTTCTTGGATGGAAAGAAGGGATTCACAGAAGTCAAGTCGCAGAATGGAGAATTCGTGACCCACAAACTTAAACACACTGAGAATACTTTCAGCCGTCCCGGAGGGAGGGCTGGCGAGGCCAAGGAGGCGGAGGGCGCGTCCCAAGTGGAAGCGGGCAAGCGCCTGGAGGAGCTGAGGCGCCGCCGTGGGGAAACCGAGAGCGAAGAGTTCGAGAAGCTCAAACAGAAGCAGCAGGAGGCAGCCCTGGAGCTCGAGGAGCTGAAGAAAAAGCGGGAGGAGCGAAGGAAGGTTCTGGAGGAGGAGGAGCAGAGGAGGAAGCAGGAGGAAGCCGATCGAAAAGTCAGAGAGGAGGAAGAGAAGAGGAGGCTAAAGGAAGAGATTGAAAGGCGAAGGGCAGAAGCTGCTGAGAAACGCCAGAAGATGCCAGAGGATGGGTTAGCAGATGACAAGAAGCCATTCAAATGTTTCACTCCTAAAGGTTCATCTCTCAAGATAGAAGAGCGAGCAGAATTTTTGAACAAGTCTGTGCAGAAAAGTGGTGTCAAATCAACTCATCAGGCAGCAGTTGTCTCCAAGATTGACAGCAGACTGGAGCAATACACCAGCGCCATCGAGGGAACGAAAACCGCAAAACCTACAAAGCCAGCAGCCTCGGATCTTCCGGTTCCTGCCGAAGGTGTTCGCAACATGAAGAGCATGTGGGAGAAAGGGAATGTGTTCTCATCCCCCGCTGCGTCGGGCACGCCAAACAAGGAAACTGCTGGCTTGAAGGTGGGGGTTTCCAGCCGCATCAATGAATGGCTAACCAAAACCCCAGATGGAAACAAGTCACCTGCTCCCAAACCTTCAGATTTGAGGCCAGGAGACGTATCTGGCAAGCGGAACCTCTGGGAAAAGCAATCTGTGGATAAGGTCACATCCCCCACTAAGGTCTGAGACAGTTGAAGAAAGAACCCCAGAGTAGCCACTCAAGATGCTGGACCAGCTCAGCTGAAGAGGGTTAATGTGCTCTGTTTTATATTTATGTTGATTTACTAAATTGGGTTCATTTCCTTTTGTTTTATTTTCCATTATCCCGGTAAACCTATGTATATTATCACCATATTTAATAATCACAGTCTAGAGATGTTCATGGTAAAAGTACTGCCTTTGCACAGGAGCCTGTTTCTAACGAAACCCATGCTGTGAAATAGAGACTTTTCTACTGATCATCAGAACTGTGTGTGAACAGTGATACCAACCACATTGGAAGTCAAACAAAAGGAGATTCAAGTTGAAAATTGCCTGAGGAATGTGTGCAGTATCCAGAAAAATGAACCGTAGTGGGTTTTGGGTTTTTTTTTTAATTTTAAATACAAAAGTCATGTTGTTTCTGCACTTTAAAGCATGGAAGAAATTATCTTAGTAGGCAATTGTAACACTTTCTGAAACTAATTCATTTCAGATTTGAGATACTATAATGATGATTGTCTTTTTAAAAAAAATGTATTGTTAAGGTATTACTTTTTTCATGCTGATGAATATCTAAATCGGATAAGGATTTTAGCTGACAGGGGTACTGATTTATTTAGGTTGGTTGCTTTGTGGATTTCTTTGGTAGTGATAGTGAACCACATTTTAGATGACCTGATCATATATGTATGTGCATACACATATACAAACACACTAATGGTAGAAAGCTTTTTCATGTGCTAGACTATTGTATTTAGCAGTATGTCCTTGTAACTAGACAATATCACAGCTTTTTAAAAATTACAAATCACAATATTCTATTAATATTTCATATTTGCCAATGGAGACATGGCAGAATAGGTATCGATATGTTTTCGATGCCCGATAGATGACCTATAAGGAAAAAGAGAGATTAGAAATATCAAAATGTCAGTTTATAGAATCAACATTTTCTATGAAACATAATATTTAGCTTATAATTAAAGGCAATCTTGAAGGCCAATGTGAATTTTACTAAATCTACCATCTGGATCAAACTCAAAGCTTGCCCAAAACTTTATTCTGTTAATAAGCGAGTTCACAATAGGTTGGCCTAAATGATACCTGAGGTCTCTTCCTTTTTTCAAATTTAAAGACAAGAATTTTAGTGACAAGATTGTGCAGACTGAAATTCCATGGACAGGTATACAAAGACCAACTTTGGCTAATGTCTAGAAGCAGGGAAGAAAAGTAAGCAAAACCCACTGTTTAGAAGTCATGACAATACTTCCATCTTTAATATACTGAACCAATTTTTAAATTAAACTTTTCTACTTATATTATTAGTCATTGGTACTTATCATAAGTTGATAATGTGTCGAACTTTGAAGAAGTATATATAACTTTTATTAGTTTTATCTTTTTCCCCAAGAGTCTTCACCAACTCATCATTTTTACACAATCCAGATATCAGATCTTATTTTAGCTTATACGTGTCCATCTGTTCTTCCCAATAGATGATAAGAGTACTCCAGTGTCTTGGAAATATGTTCTAGCATAGAGATATATAGGGTAGTTCTATAAACTTATACCTCATTTGACTTAACCAAAATGGTCCTAGTCTCAATTCCTACCACAATGAGGGAACCTCCCAAATGACTCTTTTCTAGCTCTTTTTTGGAAGAGCTAGCCAGGGCAGTGCTGGCATGAAGAGTGACCACTGCCTGACAAAGTCTATCTTCCTCAAAAATTAGTAAAGAGTAATTGAATTCTCTAGCTTTTAGCGCACCTGGGACAAAGCAAGGAAAGCCGCCTAGACTGCACAAATCATCTGCCCAAGACAGAGTAGATATGAGTCTGTGATAAGATGAACTATAATCCACAAGTAGTGCCTGATTTAGCATTGACTCCCATCATTGGGATGAAACAGATCAAAGTTTGAATTAAGGCCCATGGCGATGTAACATTGCTTTGTTGTACTTTTGAACAAGAGCTTCGCCTGATCACTATTATATATGTTTTTCTAGAAAATCTAAAGTTGAGAAGAGAATATGTCGATCCTGACTTTTATTCCAATATTTGGATGGAATAAATTTTAGGGTAGAATTTTGTTTAGTTTGGATTTAATCTTTTGAAAAACAAATTCTTTGTTTACCTGTTTGATTACAACGCTCTTTGTTATCTTTAAGAGGTAAAGCTGCAAAGTGACTAGCATGTTCTGTGAATCTGCCATTCCTAAAAATTTTATAAACACTTGATATTTGTCACTGATAATTGATCGCTGCAATAAATATGTATTGTGAAAAAGCATCCACAATAAATGGAATTCCTCC