Transcript asmbl_80940

Sequence
Transcript Sequence for observation asmbl_80940 of TGE0015159:
CACAACTAACGTCAAATCAAGGACCTCGCGTCTCTGATCTGGTTGCCCTCGCCTTATTTGAATGGGAATAATCCCGGCGAAAATCGACATATGTGAGCTAGAGCAGATTTTCGAATCGTTGTACGCCTGGGTCGGTCGAGCGTGCAGTTCGGAGGGGATAGCGTGGTACCTTTCTGTTCAGGTGTCGCCCCGGGCAGCCTCACCCTTTTCTGGGGTTTCCGTGCGGCACAGGGCTCCGTTGGTGCGCATCCAAGATGGCGACGCTGTTGGCGGTAAATTCGGCTGCTAGTCTATGGGGTCCTTACAAAGACATTTGGCAAATGGTGGGAAATGCTCTCTGGAGAAGACAACCCGAAGCTGTCCACCTGCTCGACATGATTCTGAAGAAACATAAGCCAGACTTCATCTCACTGTTCAAAAATCCACCAAAAAATGTTCAACAGCATGAGAAGGTTCAGAAGGCTAGTACAGAGGGAGTCGCCATCCAGGGTCAGCAAGGGACCCGACTGCTTCCGGAACAGCTCATTAAAGAGGCCTTTATCCTCAGCGATCTTTTCGATATTGGAGAACTGGCTGCTGTGGAGCTTCTCCTTGCTGGAGAGCACCAACAGCCACATTTTCCTGGCCTCACCAGAGGATTAGTAGCTGTCCTCTTATATTGGGATGGAAAGCGATGCATTGCAAATTCCCTGAAAGCCTTAATACAGTCTAGACGAGGAAAGACATGGACCCTCGAACTCAGTCCAGAGCTGGTTTCCATGACAACACGCTTTACAGATGAGCTGATGCAGCAAGGGTTGACTTATAAAATCCTTACTCTGGTGTCACAGATTGATGTGAACAATGAGTTTGAGAAACTACAGCGTGAGAGAGGTTTGGGCAGCGAAAAACATCGCAAAGAGGTTTCCGATCTCATCAAGGAGTGCAGGCAGTCTCTGGCAGAAAGCCTTTTTGCCTGGGCTTGCCAGTCACCATTAGGCAAAGATGACACTCTACTCCTTATTGGACATTGGAAAGAGTTTTTTTAAGAGTGACAGTTGAGGCTAATGGCTCATTGGATACAGTGAATCTGGCTCTTCTTATGGCACTTCTGTACTGTTTTGACATCAGTTTTCTAGAACAGAGCACAGAGGAACGTGATGACATGATTCATCAACTTCCACTATTGACAGAGAGACAGTATATTGCAACAGTTCACTCTCGCCTTCAAGACTCACAGCCTTGGAAACTGCCTGGACTGCAAGCCACTGTTAGACTTGCCTGGGCACTGGCACTGAGGGGAATATCTCAGCTACCTGATGTGACAGCTCTGGCTGAATTCACAGAAGCAGATGAAGCAATGGCAGAGCTCGCAATTGCTGACAATGTTTTCCTGTTCCTCACTGAATCCGTAGTAGTGTCAGAAAACTTCTATCAGGACGAATTTTATATTCGTAGAATCCATAATCTCATCACGGATTTCCTTGCACTTATGCCAATGAAGGTGAAGCAGTTGAGGAATCGGGCAGATGAAGATGCTCGAATGATTCACATGAGTATGCAGATGGGTAATGAACCCCCCATTTCACTTAGAAGGGATCTGGAACACTTAATGCTATTGATTGGTGAGCTATATAAAAAGAACCCTTTTAATTTAGAGCTTGCTCTGGAATATTGGTGTCCCTCAGAGCCTCTTCAGACGACCACTCTACTGGGTTCTTACCTTGGGGTGGCTCACCAGCGACCCCCTCAGCGCCAGGTTGTCTTGTCAAAGTTTGTTAGGCAAATGGGTGACCTGTTGCCTCCAACTATTTATATTCCTTATCTGAAAATGCTCCAGGGGTTGGCCAGCGGGCCCCAGTGTGCCCACTACTGTTTTAGCCTGCTCAAAGTCAACGGTGGCGGTCATGTTGAAAATATTCAGGGAGCAGGGGGCAGTCCTGTTTCCTGGGAACATTTCTTTCACTCCTTAATGCTTTACCATGAACACCTCCGGAAGGATCTTCCGAGTGCAGACAGTGTCCAGTACCGTCACCTTCCTTCGCGTGGCATCACCCAGAAGGAGCAGGATGGACTGATCGCTTTTTTACAGCTCACATCTACCATCATTACGTGGAGTGAAAATGCTCGTCTGGCACTCTGTGAACATCCTCAGTGGACCCCGGTTGTGGTGATTCTGGGACTCCTGCAGTGCAGTATCCCCCCTGTTCTAAAGGCCGAGCTGCTGAAGACACTGGCAGCTTTTGGAAAATCTCCTGAAATTGCTGCTTCCCTCTGGCAGTCATTGGAATACACCCAGATACTGCAGACTGTAAGGGTTCCAAGCCAGAGGCAAGCTATTGGTATTGAGGTCGAACTAAATGAAATAGAATCCCGGTGTGAAGAATACCCGTTGACTCGGGCCTTTTGCCAACTTATTAGTACCCTGGTGGAGAGCTCGTTTCCTTCTAATTTGGGTGCTGGACTGCGGCCCCCTGGCTTTGACCCTTATTTGCAGTTCCTCAGAGATTCTGTGTTTCTCCGATTCCGCACAAGAGCTTACCGGAGAGCAGCTGAAAAGTGGGAAGTTGCTGAAGTTGTTTTGGAAGTGTTTTATAAATTGCTTAGAGATTATGAGCCCCAACTTGAAGATTTTGTAGACCAGTTTGTGGAACTACAAGGAGAAGAAATCATAGCCTATAAGCCACCAGGATTTAGTCTGATGTATCATCTTCTGAATGAGTCACCAATGTTGGAGCTTGCTCTTAGCTTACTGGAAGAAGGCGTTAAGCAGCTGGATACTTATGCCCCTTTCCCTGGGAAGAAGCATTTGGAGAAAGCGGTACAGCACTGCCTTGCCCTTCTCAATCTTACTCTGCAAAAGGAAAACCTCTTTATGGATCTTCTAAGAGAGAGTCAACTGGCTCTGATAGTCTCTCCTTTAGAACAGCTTCTGCAGGGCATCAATCCCAGAACTAAGAAGGCTGATAATGTGGTGAATATTGCCAGATACCTGTATCATGGCAATACTAATCCAGAATTGGCTTTCGAAAGTGCCAAGATCCTCTGCTGTATCTCTTGCAACACCAATATTCAGATAAAATTGGTTGGAGATTTCACACATGACCAGAGTGTAAGTCAGAAGCTGATGGCTGGATTCGTGGAGTGTTTGGATAGTGAAGATACAGAAGAATTTGTACGTTTAGAAGAGGGATCAGAACTTGAAAAGAAATTAGCTGGCATCCGTCATGAAACAAGAATCCACATCTTGAATCTTCTCATCACCTCTTTGGAACGCAATCCACCCAGTCTTGCTCTCTACCTGTTAGGCTTTGAATTAAAGAAACCTGTCAGTACCACAAACCTACAAGATCCAGGAGTGTTAGGCTGCCCTCGAACGTGCCTTCACGCCATCTTAAACATCTTGGAGAAAGGAACGGAAGGGAGGACAGGCCCGGTGGCAGTGAGAGAATCGCCTCAACTCGCTGAGCTGTGTTACCAGGTGATATATCAGTTATGTGCATGCTCCGATACATCTGGCCCTACTATGAGGTACTTGAGAACCAGCCAGGATTTCTTATTTTCTCAATTGCAACATTTACCTTTTTCTAATAAAGAATATGAAATATCTATGTTGAACCAAATGTCATGGCTGATGAAGACTGCTTCGATAGAACTAAGGGTAACCTCTCTGAATCGTCAGCGGTCACATACCCAGCGGCTCCTGCACCTCTTGTTGGATGACATGCCAGTGAAACCATACTCAGATGGTGAAGGAGGAGTAGAAGATGAAAATAGGTCTGTCTCTGGATTCCTTCACTTTGACACTGCCACAAAAGTGCGTCGAAAAATTCTGAGTATTCTTGACTCAATTGACTTTAGTCAGGAGATACCCGAGCCTTTGCAGTTGGATTTCTTTGATCGGACTCAGATTGAACAAGTTATTGCTAACTGTGAACATAAGAATTTACGGGGACAGACAGTCTGCAATGTCAAGCTTCTTCATAGGGTTCTTGTAGCCGAAGTTAATGCCCTTCAGGGTATGGCAGCCATAGGACAGAGACCTCTACTGATGGAGGAAATCAGCACTATACTTCAGTATGTGGTAGGAAGAAACAAATTGTTGCAGTGTCTTCATGCAAAACGGCACGCGCTGGAGTCATGGCGGCAGCTGGTAGAAATTATACTGACAGCTTGTCCCCAGGACCTCATTCAGGCAGAGGACCGACAACTGATTATTCGTGATATTTTACAAGATGTGCATGATAAGATCCTGGATGATGAAGCAGCACACGAGTTAATGCCGGTGGTAGCAGGTGCTGTGTTCACCCTGACTGCTCACTTGAGCCAGGCCGTTCGCACAGAACAGAAGCATCCATTAGCCTTGAGGCCTGGAGAGGCCCATTACGCTTTTACGCTCGATGGTTGTTTCACCTCACCTCCTCCAGCAGAGAACCCAGTGGTGGGTTTTGCTTCTATTGGAGATTCTTCACTTCACATCATATTGAAGAAACTGTTAGACTTCATTTTGAAGACAGGTGGCGGATTCCAGCGAGTGAGGACACACCTGTATGGCTCTCTGCTTTATTATTTACAGATCGCCCAGAGACCAGATGAACCGGACACCTTAGAAGCAGCCAAGAAAACCATGTGGGAAAGATTGACAGCTCCTGAAGACGTGTTTAGTAAATTGCAGCGAGAAAACGTAGCCATCATCGAGAGCTATGGTGCCGCCCTCATGGAGGTGGTTTGTCGGGACGCTTGTGACGGCCATGAGATCGGAAGGATGCTGGCGCTGGCTCTGCTTGATCGGATCGTCTCTGTAGACAGGCAGCAGCAGTGGCTTCTGTACCTCTCCAACAGTGGCTATTTGAAGGTGCTTGTGGACAGCTTGGTAGAAGATGACCTTACGTTGCAGAGCTTACTCACCCCACAACCTCCGCTTTTAAAAGCCCTTTATACCTATGAATCCAAAATGGCATTTCTCACGAGAGTAGCTAAGATACAGCAGGGTGCCTTAGAGCTGCTGAGATCTGGGGTGATCGTGAGACTGGCACAATGCCAAGTCTATGACATGCGCCCAGAAGTGGACCCGCAGGGCGTGTTTGGCATGAGAGACCCCCCAGTGTTCATCCCTACTCCGGTGGACCGGTACCGCCAGATTCTCCTTCCGGCTCTCCGCTTGTGCCAGGTCATCCTCACGTCTAGTATGGCCCAACACTTGCAGGCAGCAGGGCAGGTGTTGCAGTTTCTCATTTCGCATTCTGATACCATACAAGCAATCCTGCGCTGCCAGGATGTTAGTGCTGGGTCTTTGCTGGAGTTGGCTCTGCTCACAGGAATTATAAGTAAAGCAGCACTTCCTGGTATATTAAGTGAACTTGATGTGGATGTAAATGAAGGATCTCTAATGGAGCTACAGGGACATATTGGAAGGTTCCAGCGCCAGTGCTTAGGACTACTAAGTCGCTTTGGTGGCTCGGACAGACTCCGTCAGTTTAAATTTCAAGATGATAATGTGGAAGGAGATAGAGTGAGCAAGAAAGACGAGATTGAACTGGCTATGCAACAGATTTGTGCCAATGTCATGGAATATTGCCAGTCGCTCATGTTACAGAGTTCCCCTACCTTTCTGCATGCCGTGTGTCTCTTCACCCCAAGCCTGTCAGAAACCGTTAACAGAGATGGGCCCCGGCAAGATACCCAAGCTCCAGTAGTTCCGTATTGGCGCCTGCCTGGTTTGGGCATTATTGTCTACCTGCTGAAACAGAGCGCTAGTGATTTCTTCAGCTATTATGACAGTCACCGACGGAGTGTCAACAAGCTACAGAATGTAGAGCAGCTTCCACCAGATGAGATAAAAGAGTTATGTCAGTCTGTGATGCCTGCTGGTGTTGATAAAATCTCCACCACCCAGAAATATGTTCTAGCAAGACGGCGTTTGGTGAAGCTGATCAACAATCGAGCCAAACTGCTTTCCCTTTGTTCTTTCATCATAGAGACCTGCCTCTTTATCCTCTGGCGCCATCTGGAGTACTACCTGTTACATTGCACGCCCACAGATTCGCAAGATTCCTTGTTCGCCTCCAGGACCTTGTTTAAAAGCAGAAGGCTACAAGATTCCTTAGCTTCAGAAGCCAATCTAGATTTTAGAAGTGGACTGACTATAGTGAGCCAACATGACATAGACCAGCTCCAGGCCGACGCTATCAACGCCTTCGGAGAATCACTGCAAAAGAAACTTCTGGACATTGAAGGATTATATTCAAAAGTTCGATCTCGCTATAGTTTCATACAAGCTCTTGTCAGACGTATCCGAGGCTTACTGAGGATATCACGGAACTGAGCTCTTCTAGGGAAGAGATGAATTGGAAAACTGTCTCCTTTTTATAGATTAGTTTGTCTTTAAATTATGACCAAAAAATATTTTGCTATTTCTTTCTTTATATATGGACATCTTTTCTGTAAACTTCTTTGCCTGGTTTCATCCTCATTAGTAAAAAAAATAAACACTTTTTT