Transcript asmbl_78264

Sequence
Transcript Sequence for observation asmbl_78264 of TGE0004203:
CCTCCGAGCCCTGCCTGCCGCAGGTTTCCAATAGCTTCTGCACACCGGAACTCAGGTGGAGCAGAGACCCAGAAGTCCTGCGCTGTTTGGTGAGCGTGTACGCATAGCGCAATCTCGCGTGCTGGCCCGGGGCGAACAGAGCTGCCAGATACTTTGTTGTAAGAAATTGAACATGGCAGAAGAAGAGGACTATATGTCTGATTCCTTCATTAACGTCCAAGAAGATATCAGACCGGGATTGCCAATGCTGAGGCAAATTCGAGAAGCTCGTCGAAAAGAAGAAAAGCAGCAGGAAGCTAATTTGAAAAATAGGCAGAAGAGTTTAAAAGAAGAAGAACAAGAAAGACGTGACATTGGGTTGAAGAATGCACTAGGCTGTGAAAACAAAGGGTTTGCTTTGCTCCAAAAGATGGGATATAAAAGTGGCCAGGCCCTTGGCAAGAGTGGAGATGGTATTGTTGAACCAATTCCTCTCAATGTCAAAACAGGGAAAAGTGGCATTGGTCATGAGGCATTGTTAAAACGGAAAGCAGAGGAAAAATTAGAAAGCTACAGAAGAAAGATTAATGTGAAAAAGCAAACTGAAGAAAAAGCTGCAGAACAGTTTCGAATGCGACTTAAAAATAAGCAAGATGAAATGAAGCTAGAAGGAGATCTTAGAAGAAGCCAGCGAGCCTGTCAACAATTGGATACTCAGAAGAATATTCAGGTTCCCAGGGAGGCCTGGTACTGGTTGAGGCTTGAAGAAGAGACTGAAGAAGAGGAAGAGGAAGAAAAAGAACAAGATGAAGATGAATATAAGAGTGAAGATTTAAGTGTACTGGACAAATTACAAATATTGACTAGTTATTTAAGAGAAGAACATCTGTATTGTATTTGGTGTGGAACAGCCTATGAAGATGAAGAAGACCTGTCTTCACATTGCCCAGGACCAACTTCCGCAGATCACGACTAAGAGTAGTCTCAATAAAGTAGAAATCTGGAAAATGCTGTTATTCTCAAAGACAGATAGTTGAGCAGTTAGAATTCCCAGATTTTGGACACCAGTAAAGAAAGAGGGCCTTATATATTTTGTTCTTTTTCTACTTTCGAAGTCCTTCATACTTTAGAATTGTTCACTGACCTCCAAAAATATAATGGAATGCTATTTCAGAACATGAGTTATAGACACGGGCCATTACAATTTATGACTCTGTTGTGATACTTATGGAGTTTAAGGGACACCAGCAGGTAACTCCCTTATTCCTCTCTTCACTTCAGAACAAATTGAAAAATAAGACATGGGAGCCAGCTTTATTATCAGTGAAGCTGAAATAGACGGCAAGGCTGATTTGTTCTCTAGTCAGACTCCCTAACATAGCTCTGTGATTGGAGAGACTGCAGACCTCGGTGAGAACACAGCCCATTTCACATTTTCAGACTAGTTAGCTTTCAAGGTGACAGAATCTACTAGGGGCTGGGCCACACAGGCTAGGTTCCTTCTCTCAATAGCACTCATCAGATAAGACATCTCTCTGTTGAAAGAGAATCAATGAGGGTTCACAGAGCTTGTTCCTGTACTTCTCAGAGCTCACTGCCTTAGCTGGGTAGCTCTAAGTGATTTTTAAAGTTATTTTTTCTGTCTTAAGCTGAAATCTGCTTCCTAAAATTTAATTGAGTACAGCTAAGGACATATATACCATGGCACACCTCTAGAGCTTCATCCAAGGTTGGGCATCAAAATCATGAAGCTTTTTTAAAATTCAGAAGCTCAGGTACCTCTCTCTTAGTGATTTTGATTCAGCTAATCTAGGATAGTTTCTTGATATCTATATTTAAAGTTCTAAGAATGAGTGTGATAAGCATATGTGGATGAGAACTAGTGCTATATATTAAACATAGAGCACTGCTATTCTTAGAATTGAGATGTCCCTGCACAGCTTACATCTCACCTTTTAGTAACACTGAGCAAGAGGTCAACCTCTTCTTCCTGTTTTAGAAACAGCATATGCAAGAACATAGCAAAAGCTAACCTATTCTGGCACAAGTTAAGATAATCAATAGTGCAACTTTTTTTTAGCCTCTGACCTAATATGACCTAATTCACTTGTTCTTGAGTTTAACTTGGGGAACTTTAAAAAATAATACAAGGGTCAGGCCCCCAGAAATTCTGATGTAGTTGGTCACCGTGGCCTTGACATGACTACCCTAATTCTAAGATGAAGCAGAGCTTGAGAATCACTAAGCTAGGTAACTTCTGGGCTTCAGTTCTTCATCCAGAAAATGGATCATTACTTTTATGAACATAAATGCATATATAAAATATTGAAGTTTATATAGTTGAATACTATTTAATATTTACTTGTTTAAAAAAAATAATAAAATTATAAAACAAAGGAGTATACCTTTCCCTTAGAATTATAGTCAACATACCGACATTCATTCAGTCAGTCCCAAAGCCATGTGGACTGTTTCACATGAAATAAGAGTCAGGAACTGGCTTCCTTTTCTCCTACTATCGGGACAACCCACCACCTGCCTAGTGGCCTAGAAGATTTTGAGTATGTTTATGAACAACTTTGTTGAGAATGGTAATAACTTCAATGGAACCCATCACTCCACTAGAGTTGTGGTCTGCATTTCCAAGCCAAGGGCTAGAACTAGGCCTGCCTTGGAGAGTGGGAGGCATCCCTCCATCCTTATCCATCAACATTTAAAAATAACAGCTTTCAATATGAGTAAAAACATTTTTATTCACATAGGACTTTTAGGACTTCATAATTAAATGATGATGATAACCCAGGAAAGCAAAACGTTGAAAGAATTTTTTAAATTTGCTTTAGGGCATGTATATGAAATTTGAAATGTCATTCATTTTTGTTTATATTGCGCTATATTAAAGTCCTATCTAGAACTTCTAAAATGTTTATTTTCCTGATTATATATCCAAAATACTAGAGCTTCTAAAATTCAAAATAAGACTTCAGTGCACCATATTAATTAATCTTAACATACCTTTAAGTGTTACTTGCCAAACATTTAATTGTTGAAATTTTAAAGTGAACATTATTTAGTGCTAGATACATTTTGTAAGATCAATAATATGAATTTAACACTTATTACCCACCACTTCAAAAACACAGAGTTCCTGCTTTAATGGAGGGCAGTATACTCACTGCCTTGAAGTATACAAAATTAAGAGTGCCTGCTTTCTAGAAATTCACAGTATGAGGTTAAGAGCCACGTAGAAATAACAGCTCCAATGCATACTGGTAAGCACAATACTGAAGCACCAATGAGTGTACTAAGGGAGAAGTTTTACTCTGAGCAGGAGACAGTGGAACACTGGAAGTGGCAGGGAATGTAGGTTTGAGCATAACTGACAGGCAAAGTCATGAGGGAGGAGTTACAAAATGACCCCACATTTCCACTCAGGTATATACATGGGAGAAATGGAAACACGTATCCACATAAAATCTGTACATGAATATTCATAGTAGCACTGTTCATAATAGCAGAAAAGTGGGAACAACCCAAATGTCCATCAACTAATAAA