Transcript asmbl_77797

Sequence
Transcript Sequence for observation asmbl_77797 of TGE0004210:
GGGACTTCCGGTCCGGGGGAAGCCGTGCGAGAACCGTCACGTTAGAGCCCGGTTTCTTCTTGGCGGACAGAAATGGACTCAGAAATCAAGGAGGAAATTCCCGTGCATGACGAATACGTTTTATGTGGCGGAGCTGAAACCTGCGTTCTGAAGTGTGGGCCCTGGACTGACCTGTTTAATGATCAGAGCGCCAGCAGACCTAAGCTGCTCATTTTCATTATTCCTGGTAACCCAGGTTTGCCTGCCTTTTATGTACCATTTGCAAAGGCTTTGTACTCTTCAGTAAACAGACGCTTTCCAGTGTGGGTTATCAGTCATGCTGGGCATGTTTTGGCTCCCCAAGACAAGAAGATTCTTACAACCTCGGATGATCCAAATGCTCAAGAAATTAAGGACATCTACGGACTCCGTGGTCAAATAGAACACAAGATAACTTTCCTGAGAACTCATGTGCCAAAGGAAACGAAACTGGTGGTCATTGGCCATTCAGTAGGCTCCTATATTTCCCTTCAGATTTTGAAGCATGCCCCCGAGCTCCCAATAATTCGCTCCTTCCTGCTCTTTCCAACAATTGAGAGACTATCTGAGTCACCCAACGGCAGAATCGCCACTCCGTTATTATGCTGGTTTCGATATGTTTTAAATGTTTTTAGCTACTTGTTATTTAAACCATGTCCGGAGAAAATCAAGTCCTGGTTGCTCAGGACGAGCTGTCAGATAATGAACCTGCAGGATGAATGTTCAGTCCAGAATGTGTTGGAACCTTTCTGCCTTGTTAATATTGCCTATCTCGGTGGCCAAGAAATGATGGAGATAGTAAAGAGAGACAACGAAACCATAAAGGAACATTTGTCTAAGCTTACATTCTACTATGGTGCTAAAGATGCTTGGTGTCCAAAAGAGTACTATGAAGACATAAAGAAAGACTTCCCAGAAGGAGATATTCGACTCTGTGAGAAAAAAATACCTCATGCTTTTATCTTATACTCTTACCAAGAAATGGCCGACATGGTGGCAGACTGGCTTAAGGACGATCTGTCCAAAATTGAAACGGTGACAGAAGAAAACCAGGACTGATAGCTGGCACGTAGAGGCGATAAGTATACTGCCTCTTTGTAGCAAGTAGTGCACTTAGTAGGTAAATGTTTAATTTTGATGTTTAATAATCGGAGAGAAAAAAAGTGAGAACCTCTCGGCTTACAGTCTGCCCACTCCCAGTTCCCCGTGCTACAGTCTGTGGTAAACACGGTTGATGGAATATTCCATAAATTTAACCTCACCTTTTCCAGGACTCACAACATGGAGATCTAGATAGGTCTCTTCCGTTTGCACGAGACGCCCAGTGGCACAGCTTATTTTGGTAGGCAGGATCGTTGCAGACAAAAGGAAGTCTAAATTTAGTTTATTTTAACTGATTTACCTTATAGAATGGCTTCTCCTAGAGGAAATTATTAAATAACTACTAGAAAATGTAAAAGAGATCAGTGAATGTTAAGTGTATAATCAGATATGTGAAGTGTATGAGATCGTGAGAAGGACATACTCATGTACCAACAGCAGGAAGTGATGAGCCATGGATCTTGGCAGCGGACCTGGGTCTCTCTTAAGGACAGAAGTTGAAGATTAGCCCAGACTAACTTCGTAAAGGCCTTGCCTGAGATCATCAGAATCAGGCTGAATACCAGGGCAGCCTGCGCCCACCTGTTCCTACCTTGCAGTACGTCGCAGACCACCAAGTCGGCCTTTTGTCTGAACACCAGTGGCACGAGCCCAAGGAGAGCCAACATTGGGGGAGGTGCTGCTCATCCTCACCTCTGAGAAGCATCCCTGAGGAGTGTGACTCCCTCATCCACCTGCCTTAGACAGGGAATGAGGTTTGACAGCCTTTGCCCTAGTCAACTAACCAGAGAAGAGTCGTTCAAGGATCCTGACTCTGCCTCCCCACCACAAGGCAGCCAGCCAACTCTGTGCCGAGCCTTAGTCTGCCGGACTGTGAGCTCCCTGCATGCTCCTCTTCTCCAGAGCCAGATGCGGAGTCCCTGGACTGTCCCAAATCAATCCTGTATGTACCCACCACATGCAGTTCCTCTTCTGTGATTTTTTCAGTGAAACTCCACTGAGGACCAGCAATGAGCCAAGTACTGTGCTGTGCATTGTGTATAGAGTTCTTAGCTATATTATGGTTCTTTTCTTCTGAAAATCTTCTAGTAAGTAATTTCCAAAAGGGCATCTTTAAATGAGGATTACCATAAATGAGTTCTCCATTTCTGCATTAGCTGTGTTAGTTGGAAATAAATCGTTTTACTAATGAACCAAAACAAATCATTAAATTATGTAAATTCACCTTCTCTGGAAACCTTGAGGTCCAATAGAGAAGAAGCTTGCTCTCTGGCCCAGAGTAGGCTAACAATTTTGCTGCCTTCCCCGAATTGACTCAATCCTGAGGCCTTAGGAGCCAATAAATCCCACTGACTACAGTGATGGTTGACCATGGACCAGAAACATTGGGGTTTTGAAATCCCTCAAACATTATCATTCTTTAAGGACAAGAGGATGTTGGCCTTCCTCTCAAAACCTGAAGCCCCCTGATGAAAGATTCAGGTCTGATATGCTGCCCACACCGCAGTGAGTGTTGAACGAGTTACTCTCTGTCAGGGCCTCCCCATCAGAGCAAGCAACTCCTCGGAGGGGAAGGTCCACGCTCCAGGCATGGAGTATTCTTGGCCGTGGAGAGGAGCCAGGACACTCAGAGGCCATTGGCTCAGGGCTGCACACAAAGTCCTTGTTGGCATCTGTGTGGAAGGTCTAGAAATCTGACGTTAGAGGCTAGAGCTCATGGACACCTCACTGTCCTCACTTATAGGATTAATAATGATAATGCATTAATAATAATGCATACCTCATATTGCTGGAAGAATTAAAGTAGATGATAAAATTAAAGCATTTAGCACAATGCCTGACCAAGAGTATCTTCTGAATAAAGACTGGCTGTAATAATAATTATTATTAAATATCACAGTAATAAAAATGAAAGACTAAGATTTATCAGCAGTGGATGAAATCCATTTTCCAGAAGCATCTCTGCCGGTATGTTCCAGTTAGCCCCATGGCTGGTCCTCGGCAGTAATTTCATACGGAGTTGTCTTCTTCTGTTCTCAGTCTGCTTCGCGCCGTGGGAGAAGATCTCCAGAGACAGGCCCCTGCGCTCGGGCTGATACCCAAGGCAGGCAGGGCCCTCTCTCCGTCTGCTTCTCTCGACCCTTGGAGAGCCAGTGACCTCCAGAGGCTTGATTTTTCTTCACCTTACATTATACATAAGATTAAATTTAATTCCAGATTAAGGGAGACTACAAAGACATGACCACATAATGCAACACCTGATTCTGGATTAGGTGTTTTTGTTACAAAAAGCATTGTTGGGACAATTCGCACGATTTGAATAGGGTCTGAAGTTCAGCTGGGAGTAAGAGATGTTAATTTTCTGATTTCAACGGTAGCGTTGTGGGGGAATAGGGGAATGTTTCTATTTGTAATGACATGCCTGGGGCGATGGGGCAGCTTGTCACTTTACTCTCAAATGGTTCACGGGGAAAAAAACATTCTTTGTACTTGCAACTTTTTTGTAAGTTTGAGATGATTTTGAAATTTATAAAAATAATTATTAAAAAGAAAACCATGCTCTCTCCTTCTA