Transcript asmbl_77744

Sequence
Transcript Sequence for observation asmbl_77744 of TGE0001355:
CAGCTGCGCGGCGGCCCGCCCCTCGGCTCGGTGGTAGGCTGAGACGGGAGGGTCCTCGGCTAAAGCCCAAAGCGGATCAAAGTGGTGGGACTCGCGCCGCGGCCGCGGAGACGTGAAGGCCCTCCGCACGCTCCTCCCGATCCCGGTCGGTGCTCGCCCTCGCTGTGCTCCCAGTCCCCATGGAGAAGACGGAGCTGATCCAGAAGGCGAAGCTGGCCGAGCAGGCCGAGCGCTACGACGACATGGCCACCTGCATGAAGGCCGTGACGGAGCAGGGCGCCGAGCTGTCCAACGAGGAGCGCAACCTGCTCTCGGTGGCCTACAAGAACGTGGTAGGGGGCCGCAGGTCCGCCTGGAGGGTCATCTCGAGCATCGAGCAGAAAACCGACACCTCCGACAAGAAGTTGCAGCTGATTAAGGACTATCGGGAGAAAGTGGAGTCGGAGCTGCGGTCCATCTGCACCACCGTCCTGGAATTGTTGGATAAATATTTAATAGCCAATGCAACTAATCCAGAGAGTAAGGTCTTCTATCTGAAAATGAAGGGAGATTACTTCCGGTACCTTGCAGAAGTTGCATGTGGTGATGATCGAAAACAAACGATAGATAATTCCCAAGGAGCTTACCAAGAGGCTTTTGATATAAGCAAGAAAGAGATGCAGCCCACACACCCAATTCGTCTGGGGCTGGCTCTTAACTTTTCTGTATTTTACTATGAGATCCTTAATAACCCAGAGCTTGCCTGCACACTGGCTAAAACGGCTTTCGATGAGGCTATTGCAGAACTTGATACACTGAATGAAGACTCTTACAAAGACAGCACCCTCATCATGCAGTTGCTTAGAGACAACCTAACATTGTGGACATCAGACAGTGCAGGAGAAGAATGCGATGCGGCAGAAGGGGCAGAAAACTAACTGCACGCAGGATGTCGTCCTTCTTCCCTCCAGAAACCTTTTTACACATCTCTGTTCCTTATTCCATTCGGATTTCCTATAGCGAAGAAACGCATTCATGTGTATGGAATCAACTGTTTATAGTCTTTTCACACTGCAGCTTTGGGAAAACTCCATTCCTTGATTTGTGTTTGTCTTGGCCTTCCCGGTGTGCAGTTACTGCTGTAGAAAAGTATTAATAGCTTCATTTCATATGAACATAAGTAACTTCCAAACACTTACATAGAGGACTAAAAATGTATCTGGTATTTAAGTAATCTGAACCAGTTCTGCAAGTGACTGTGTTTTGTATTACTGTGAAGATATGAAAATGTAGTTAATTACAGTTTAAAGAGTGTTCTACATAACTTCTTAATTTCTACATTCCCTCCCTTACTCTTTTTTTGGGGGTTTCCTTTCAGTAAAAACTTTTCCATGTTCTTAATGTATTCCTTTTTGGTAGGAATTCAGAAGTATTAGATTGAATGGAAAAGCATTTGACATTTCCGGGCTGGGGGTCACAAATTAAAATGCCTCCTGTATCACATACAATGGGGTTCCTGTGTATCTGTGACAACAGGGAGTTTCCTTATTCACTCTTCATTTGCTGCTGTTTCAGTTGACAACTTCCCTTCCCAATAAAAATTCACTTACGCCTCCCGCCTTTGTAGTTCTGGTATTCACTTTACTATGTAATAGAAGTAGCATGTTGCTGCCAGAATACAAGCCTTGCTTTTGGCAAATTAAAGTGCATGTCATTTCTTAATACACTAGAAAGGGGAAATAAATTAAGTACACAAGTCCAAGTCTAAAACTTTAGTACTTTTCCATGCAGATTTGTGCACATGTGAGAGGGTGTCCAGTTTGTCTAGTGATTGTTATTTAGAGAGTTGGACCACTATTGTGTGTTGCTAATCATTGACTGTAGTCCCAAAAAAGCCTTGTGAAAATGTTATGCCCTATGTAACAGCAGAGTAACATAAAATAAAATTACATTTTATAAACCATTTACTATGGCTTTGTAACAATTGCATACTCATATTTTAAGGGACAAGTGAATTTACTACTTTCTGAAGTTTATTGATACTTCCCTTTTATGTAAAATGTAGTGATGCCCATATTTCTGCATTGTAATACACTTGTCTAGGGATGTCTGGAAATGTATAAAATTGGCCTACGTTTCTTAGAGTTAGTGTTTTATTCACAGATCGGTTTTGTGGGCCATCTCTTTCTCAGATGTAAATGATACCTAGTTAAGTGTTATATGGAATAAAGTGGACATTTTAAAACTAGAAAAGTTAATTATGTGATTGTGAATGCTTTGGGTGGTATTAGAATTAAGCTTTAGCGGATATTCAAACAATGTCAAAGTACAAGAATACTTCGTTTAGTTTTCAAAAATTCCCTTTATAAACATTCAGTTGTATCATTAGTGAGTTCCAAATAATTTTAGTTTTATATTATCACAATGGCTGTTTTACTCACCTGTCTTAAGTATTATATTAGCCAGAGAATTTAAAGTCAAGATTATCCTTGTAAGATTGAAAGATTATCCTTTATCTCCTAAAGTGTGACTCTGAAACAGGGTTTCATTTGCATTTGATTTGTTTCCTGAGGGAAAATGAAAGAGAATTGAATGGGACTTGGGAAAATATTCATTTAAATAAGATTATTAGGATTTTGGTCCACCAAAATCTAACAGTAAAACTACTTTTTTAAAATAAAACTTTCAGTAAACGTGGGAAGAACATTGTGAATTAGGAAAAATGATCACGTAACAATAAAGTGGTTAAGTACTGAATCAAGTAATCAGTGAGTTATCAAAGTAACTTTTTTCTTTTGCTTAAACAATAGAAATGTATTACAGTTCTAGCAGCAGGAAGTCTGAGATCAGGGTGCCAGCATGGTCAGGTTCT