Transcript asmbl_77450

Sequence
Transcript Sequence for observation asmbl_77450 of TGE0004164:
TAAGTGAGCTCCGGCACCGCGGATTTCGGGGGAGAGGGGTTGCTGCGAGTGGCGGCGGCGCCGATCTCCATGCGCCCGGGCAGGCCTGGGGAGCCATGCCGGGCTGGATTGAACCAGCTCCCAGAGAGGCTCCTCCGCTGGAGCCCGTCGCCCCCTCGCCCTTTCCGGCGTGGTGAGGTGGCTTTGAACCCGGGTTGCCCGGCCAGCGCGACCAAGGAGGTGGCTGGAGGACTGGAGAATGAACGGAGAAGCCGACTGTCCCACAGACCTGGAAATGGCCGCCCCCAAAGGCCAAGACCGCTGGTCCCAGGAAGACATGCTGACTTTGCTAGAATGCATGAAGAACAACCTTCCATCCAATGACAGCTCCAAGTTCAAAACCACTGAGTCACATATGGACTGGGAAAAAGTAGCATTTAAAGACTTTTCTGGAGACATGTGCAAGCTCAAATGGGTAGAGATTTCTAATGAGGTAAGGAAGTTCCGTACATTGACAGAATTGATCCTTGATGCTCAGGAACATGTTAAAAATCCTTACAAAGGCAAAAAACTCAAGAAACACCCGGACTTCCCAAAGAAGCCCCTGACCCCTTATTTCCGCTTCTTCATGGAGAAGCGGGCCAAGTATGCTAAACTCCACCCTGAGATGAGCAACCTGGACCTGACCAAGATCCTGTCCAAGAAATACAAGGAGCTGCCGGAGAAGAAGAAGATGAAATATATTCAGGACTTCCAGAGGGAGAAACAGGAGTTCGAGCGAAACCTGGCCCGATTCAGGGAGGATCACCCTGACCTAATCCAGAATGCCAAGAAGTCGGACATCCCCGAGAAGCCCAAAACCCCCCAGCAGCTGTGGTATACCCACGAGAAGAAAGTGTATCTCAAAGTGCGGCCAGATGCCACTACGAAGGAGGTGAAGGACTCCCTGGGGAAGCAGTGGTCTCAGCTCTCGGACAAAAAGAGGCTGAAATGGATTCATAAGGCCCTGGAGCAGCGGAAGGAGTACGAGGAGATTATGCGTGACTATATCCAGAAGCACCCTGAGCTGAACATCAGTGAGGAGGGCATCACCAAGTCCACCCTCACCAAGGCCGAACGCCAGCTCAAGGACAAGTTTGATGGGCGACCCACCAAGCCACCTCCGAACAGCTACTCGCTGTACTGTGCAGAGCTGATGGCCAACATGAAGGATGTGCCCAGCACAGAGCGCATGGTGCTATGCAGCCAGCAGTGGAAGCTGCTCTCCCAGAAGGAGAAGGATGCCTACCACAAGAAGTGTGACCAGAAAAAGAAGGATTATGAGGTGGAACTGCTCCGTTTTCTGGAGAGCCTGCCTGAGGAGGAGCAGCAGCGGGTGTTGGGAGAGGAGAAGATGCTGAACATCAATAAGAAGCAAGCAACCAGCCCAGCCTCCAAGAAGCCCTCCCAGGAAGGGGGCAAGGGTGGCTCAGAGAAGCCCAAGAGGCCCGTGTCGGCCATGTTTATCTTCTCTGAGGAGAAGCGGCGGCAGCTGCAAGAGGAACGGCCAGAGCTCTCAGAGAGCGAGCTGACCCGCCTGCTGGCCCGCATGTGGAACGACTTATCGGAGAAAAAGAAGGCCAAATACAAGGCTCGGGAGGCTGCGCTGAAGGCCCAGTCGGAAAGGAAGCCTGGCGGAGAGCGCGAGGAACGGGGCAAACTGCCCGAGTCACCCAAGAGAGCAGAGGAGATCTGGCAACAGAGTGTCATTGGCGACTACCTGGCTCGCTTCAAGAATGACCGGGTGAAGGCCTTGAAAGCCATGGAGATGACCTGGAACAACATGGAGAAGAAGGAGAAACTGATGTGGATTAAGAAGGCGGCAGAAGACCAAAAGCGATATGAGAGAGAGCTGAGTGAGATGCGGGCACCTCCGGCTGCTGCAAACTCATCCAAGAAGATGAAGTTCCAGGGAGAACCCAAGAAGCCTCCCATGAACGGTTACCAGAAGTTCTCCCAGGAGCTGCTGTCCAACGGGGAGCTGAACCACCTGCCGCTGAAGGAACGCATGGTAGAGATTGGCAGCCGCTGGCAGCGCATCTCTCAGAGCCAGAAAGAGCACTACAAAAAGTTGGCAGAGGAGCAGCAAAAGCAATACAAAGTGCACCTCGACCTCTGGGTCAAGAGTCTGTCTCCCCAGGACCGAGCAGCATATAAAGAATATATCTCCAATAAACGTAAGAGCATGACTAAGCTGCGAGGCCCAAACCCCAAGTCCAGCCGGACTACCCTGCAGTCCAAGTCGGAGTCTGAGGAGGAGGATGACGAGGATGAGGATGATGATGACGAGGATGAAGAGGAAGAAGATGATGAGAATGGAGACTCCTCTGAGGATGGCGGGGACTCCTCTGAGTCTAGCAGCGAGGATGAGAGCGAGGACGGGGATGAGAATGAGGATGACGATGAGGATGATGATGAGGATGATGATGAGGATGAGGATGAAGACAATGAGTCCGAGGCCAGCAGCTCCAGCTCTTCCTCCTCAGGGGACTCCTCAGACTCTGACTCCAACTGAGGCTGGGCCCCACCCGGGGCTCCCCTCCCCAACTGACCACCTTTGTTTCTCCCCCTTGTTCTGTCCCCTGCCCATGACCCACCCACCCCACTCCCCACCTCCTCCAATTTTTCTTTCTTTTTTTTTTAAACAATATGGTGGGGGAGGGGCTGGAGGAGCTCAGGCCAGGACTCTGCAGCCTCAGAGACATCAGCCCTGGGGGCCCTCCAGGGAGCAACCATCAGACTGAGCCACCACTGGACCGGCCCAGCCCACCCCTCTGCACTTGCGGTTCTGGCATGGACAATGGACCTGGGAGTGGGGTGGGGGGGTTCCCAAAGAGTTCAGTGAGGCCCGCTACACCTGCAGCCCAACCCAAGGGAGGGTGGAAGCTTGGGGAGGACCCCTGCCTTCCCAGAGAGGCTTGCCACCTGGACCCCTACATTGGAACTGGAGGCAGGGAACCTGGGGAGAGGAGGATGGGTGCCTATGAGAAAACAGGCGCTGCCCCATAGACCTCTCCCCTGCCCCCTGCAGGAAGGAACTGCCTGGACCCAGTCATGGGGGGAGGGGCAGAAGTGTTTTTTATATATGTGTATATATTTTTTTTTTAAGCTCTGAGCTGTCAACGAGACGTTTCCTACCGATATCGGCTGCCGTCTCTGTTGTCATTTCTGGGAGAGGGAGGGTTTAGGGGTAGGTTTGGGAATTTTTTAAAACCTGGTATGTATGGAAAA