Transcript asmbl_7601

Sequence
Transcript Sequence for observation asmbl_7601 of TGE0004434:
GGCCCATCCCCCTCCCTTTGGGTTGGGCTCCCTTTTATAAAGGGCCACGCTGTCCCCCACTTGGAAGCAGCTTTTTGGCTCCTCCAGAGTCTGTCAGTTTCGGCTCCTCGCCTTCACTCCAGCCTCCAACATGTCCGTGAGGGTGACCCAGAAGACCTACAAGATGTCCACCTCTGGTCCTCGGGCCTTCAGCAGCCGCTCGTACTCGAGTGCTCCCGGTTCCCGTATCAGCTCCTCGGCCTTTTCCCGGGTGGGCAGCTACCGGGCTGGCCTAGGCATCAACATGAACCTGGCTGGGGGTTACGGCGGAGCTGGAGGTGCGGGGAACATCACAGCAGTCCAAGTGAACCAGAGCTTGCTGAGCCCCCTGAAGCTGGAGGTGGACCCCAACATCCAGGCCGTGCGCACCCAGGAGAAGGAGCAGATCAAGACCCTCAACAACAAGTTTGCTAACTTCATCGACAAGGTACGGAGCCTGGAGCAGCAAAACAAGATTCTGGAGACCAAGTGGAACTTTCTGCAGCAGCAGAAGACGATTCGCAGCAACATGGACAACATGTTTGAGAGCTACATCAACAACCTTCGACGGCAGCTGGACACGCTGGCCCAGGAGAAACTGAGGCTAGAGGCAGAGTGTGGCAACATGCAGGGGCTGGTGGAAGACTTGAAGAATAAGTATGAGGATGAGATCAACAAGCGCACAGAGATGGAGAATGAATTTGTCCTTATCAAGAAGGATGTGGATGAAGCTTACATGAACAAGGTAGAGCTGGAGTCTCGCCTGGAAGGGCTAACCGATGAGATCAACTTCTATAGGCAGCTGTATGAAGAGGAGATCCGTGAGCTGCAGGCCCAGATCTCTGACACGTCCGTGGTGCTGTCCATGGACAACAACCGCTCCCTGGACCTAGATGGCATCATCGCCGAGGTCAAGGCCCAGTACGAGGACATCGCCAACCGTAGCCGGGCTGAGGCTGAGACCATGTACCAGATCAAGTATGAGGAGCTGCAGACGTTGGCTGGGAAGCATGGAGATGACCTGCGTCGCACAAAGACAGAGATTTCTGAGATGAACCGGAACATCAGCCGACTCCAGGCTGAAATCGAGGCCCTCAAAGGCCAGAGGGCTTCCCTGGAGGCCGCCATCGCTGATGCCGAGCAGCGTGGGGAGCTGGCCCTCAAGGATGCTCAGGCCAAGGTGGCTGAGTTGGAGGCTGCTTTGAGAAATGCCAAGCAAGACATGGCCCGGCAGCTGCGCGAGTACCAGGAGCTCATGAACGTCAAGCTGGCCCTGGATGTGGAGATCGCCACCTACCGCAAACTGCTGGAGGGCGAGGAGAGCCGGCTGGAGTCTGGGATGCAGAACATGAGTATCCATACCAAGACTACCAGTGGCTACTCAGGTGGGCTGAGCCCGGCCTATGGAAACCTCACAAGTCCTGGCCTCAACTACGGTGTCAGCTTCCAGTCCAACTTCGGCTCTGGGGGGAGTTCCGGCTCTTTCAGCCGCACCAGCTCCACCAAGACCGTGGTGGTGAAGAAGATCGAGACTCGTGATGGGAAGCTTGTATCTGAGTCATCTGATGTCCTGCCTAAGTAAATGGCTACCGTGGTCCCTCTTGGCCTTTCAAGCCTGTGGGAAAGGAGCTGTGCAGAGAGCCTTGAACACAGGAGACCCACCTGAAGCTCAGCCCCAGTTCTCAGCCCCAACCCTGGGTGGGGAATCTACTGCCTGGAGGACCGCCTCTTACCCACGCCCCTAACTAAAAGCCAAATCAAGTGTTTTTTCCAAAATAAAGTCTCAGCTGGCTCTGCCAACCTT