Transcript asmbl_74399

Sequence
Transcript Sequence for observation asmbl_74399 of TGE0004133:
AGGCGGGAACCACTGTCCCTGGTCAACGTGCGGAAGAGGAGCCTGGAATCTGGAGACGACGACCTGCCGACCAGGATGGACCACTACAAAGCCAAGGCTACGCGGCACATCTTCCTCATCAGGCACTCGCAGTACCACGTGGACGCGTCCCTGGAGAAGGACCGCACTCTGACGCCCCTGGGTCGTGAGCAGGCTGAGTTGACTGGTCTCCGACTTGCAAGCCTGGGGTTGAAGTTTAATAAAATCGTGCATTCCTCCATGACCCGTGCGGTGGAAACCACCGACATCATCAGTAAACACCTGCCAGGTGTCTCCACGGTCAGCACAGACCTGCTGAGGGAAGGTGCCCCCATCGAGCCCGACCCGCCCGTGTCGCACTGGAAGCCGGAGGCTGTGTATTACGAGGACGGGGCCCGGATTGAGGCTGCCTTCCGCAGTTACATCCACCGGGCAGACACCAAGCAGCAGGAGGACAGTTACGAGATCTTCATCTGCCATGCCAACGTCATCCGCTACATCGTGTGCCGGGCGCTGCAGTTCCCTCCGGAAGGCTGGCTCCGTCTCTCCCTCAACAATGGCAGCATCACCCACCTGGTGGTCCGGCCTGATGGCCGAGTGGCACTCAGGGCTCTTGGGGACACGGGCTTCATGCCTCCCGACAAGATTTCCCGCTCCTGAGGCCGCTGCGAGGCCAGTGCCTGGCTCTGCTGCGGGAGCCGGGAACAAGGGCCGTGTCCCCTGCCTTCCGTCCGCAGGTGGCACTGCGGTCGCTGTTTCTCCAGGATGAGGCTGCGGAGTGGAAACACCTGCCACACGGCACATCGTCATCCTCCTGCCCAGAGTGGCAGGGGGCGCTCGGGCCCCGCTGCCGGGTCTCCCCAGGTCCTCTGCCCCAGGCTCACCTACTAGGATGGGCCTGTGGGGGTGGAGGCCCCGCGGGGCCCTGCAGGTGTGCACCGGGGCCTGTGGCCAGGACCGCGACCGCAAGAGGCAGCGAGCCCATCAGGCTGAGGGCGTCAGGAGGGCCCGGCGCTTCCATCCTAATGTCTTTGCTTCGTACGTTCTTTTTGTAAGATCCTCTCGTCACTTATGTTAAAGACTTTCCTCACCTGGGTTCTTTTCTGAAAACCGATTCCTCGCTCCGGAGTTACGCACCCCTGATGCTACTGCATCTGAACTCACGTGTCTTCAAGGCCTTTGCGGACATGGGCACCCAGGCAGGTGGTGGGGGCCAGGGGGAGAGGGTCCTGTTTAAAATATCCAGCTGATGGCTGAATCTTTGTTTGCCTCTAGCTGTTAATCTTTTATGCTTATGGATGAAAACATTTAGACACGACATGTCCATCATAAGTATTCTGTTAATTTACCAAAAACCCTACAATTTCTGCGAAGTGGTTATGGACATTTTCTGCTGTGATCAGTGCAACTGAGATATTTGATCCATTTCTGTTAACTTGGAAATAACTACAAAATAAAGTTTTATTTTACTGGTTTTTCAAA