Transcript asmbl_73056

Sequence
Transcript Sequence for observation asmbl_73056 of TGE0004108:
CGCAGAGGCGCTCGGCATCGGAGGCTTTTACGTCATCACGGCGCGACGTCCCGGGGGACAGTTTGGGGATCTGGCTAGCGGGAAGGTGTGGCGGCGGGACCATCCGGGAAGATGCCCGTGGCCGTGATGGCAGACAGTGCCTTTAGTTTCAAAAAGCTGCTGGATCAGTGCGAGAACCAGGAGCTCGAGGCTCCTGGAGGAATTGCTACACCTCCAGTGTATGGTCAGCTTCTAGCTTTATATCTGCTCCATAATGACATGAATAATGCAAGATATCTTTGGAAAAGAATACCACCTGCTATAAAATCTGCAAATTCCGAACTTGGAGGGATTTGGTCAGTAGGACAGCGGATCTGGCAGAGAGATTTCCCTGGGATCTACACGACCATCGGCGCTCACCAGTGGTCTGAGACGGTCCAGCCAATCATGGACGCGCTTAGAGACGCAACGCGGAGACGCGCCTTCACCCTGGTCTCGCAGGCGTACACCTCCATCGTCGCCGAGGACTTCGCCGCCTTCGTTGGGCTCCCTGTGGAGGAGGCCGTGAAAGGCATATTAGAACAAGGATGGCAAGCCGACTCTACCACAAGAATGGTCACGCCCAAAAAGCCAGTCGCAGGCGCCCTGGATGTCCCCTTTCACGGGTTCGCTCCTTTATCAGAGCCAGCCCCGGTCCCGCCCATCCCCAACGAGCAGCAGCTCGCCAGACTCACCGACTACGTGGCTTTCCTCGAAAACTGACCGGTCCCGCCTCCCGGACCCACCCCGGAGCGCTGTGTCCTGAACTGATCCAGAAATGCTAAATTTTTATTTTCAGCTTATTGGATGGATTCAGCGCCTCAGCCTTCCTTCCTGAGTGTGCGATGGTAAAACACACATATACTGTAAAGCGCATCATGTGTATTTTGTCCTTAAGCGCCCCGCTGACTAGTTGAAGCAGGCCCGGTTTCATCACGCCACAGTGCGGGTGGGCCCGCCGGTGTCACGCAGCCCGTGTGTGTCCCAGCGGCTCGTGACTGAGCTCCCCTGCGTCCTGTAGCCAGGTGCCCGTCACCTGTGTTTCCCGGTCACGCACAGCACACCGTTCCTGCTGCTGGCCGTAGGGGCGCGCCCGGGGAGGAAGGCTGTGCCCGGCGGGACCTGCACTGTGGGGCGCTCCCATCCGCCCCCTCGGGAGAATGCGCACTCTGCTCCTCGCCCCGGAGTTGCCACTGCAGAGACGCAGCCGGGGACCCGAATGGTCTCAGGAGACCAGGCTGTTTTCCCTGGCTTCGCTGATGGTGTGAGCGCGCCCGTGGCCGCAGTGGAGGGCTTGCCGTGGAAGTGAGCCTCATTAAGACGTTCGCGAGATGCGTCACGCTGTCACACGGCCCTTCAGGAGAGGGGAGCCCTGCACAGGGATGCGTCATCCTGGGACAGAAGCCGTGAAGATGACGAGCAACTTTGTCCAGCTGCCCTGCAGCTCCCGGTTGCTCACGTTTGACCCTCGGTTCAAGCTCTGCCTTTTGGAGAAATGCGGAACGAGCCCCTCCTTTTCCCGTGTGACGCCCTCTGAGTGTTTGAAGCTGTTTATTGTGTCTTCAGGTTAAAACATCCCTGCATTCATTCATTCTGCATTTGTTCAATAAATATTTAATTGAATTCTTCAACTGTTTCATCTGAGGCAATTTCTGGACATTTCACTATCCTGGTCTTTCTGTGGCCACGTTCTGCTTTGTGACTGTCTCTTGAAATATGACTTTCTTAATTAGAAACGACCGATATAGCGATAGTTACGTGACTTGTGTCCTCATTTTACATACATTTTACTGGCTGTTGCAGTTTCTGTTAACATTTATGGAAATACCTTTTAAGTTAATTTACTTGACCTTGAGCGGTAGGTCACGTTGTTAAAACTCGTCGTTTTACAGTTTAGGAGATGGAAATTCAAGCAGTCGGGGTCAGTGGCCGGAGAGCCGCGATGCCAGTCCCTTCAGCTCCGGGTTACTACCTGCGAACCGCGTCAGCCTCACAGCTCCCAGCAGCTTCCGTTCAGAGAAGCCAGTCGGTAACCAGGAGCTGAGTGTGCGCCTGTGGCCGCAAAGGGTGAGGACCCCACACACTGCAGCAGCGACACCCGCAGCGCGGGGTCACGGGCTCCATCGCGCTGAGAGGGCGGCCGGACTCACGGCACACGTGCGTGTTCACTCTCAAAAAGAAACGGCGGAAGGGTAAGCTGAAAACTAATAAAAACGGTTTCCTAAAGGGTAAGGGAACAGCAGTGGAGTAAGTAGACAGAAAAAATAATTTCACGTGACCCAAACGCAGCATTTTGACTCCATTTGTCCGGGATGTATACTGAGGACAGAAAATCTTGAGACAGCTGAATGTGATTTCATAGTGAATAAACACTCCCTTTTTAATTTCAAAAGAAC