Transcript asmbl_72982

Sequence
Transcript Sequence for observation asmbl_72982 of TGE0004126:
GGGAGGAGTTCATACAAGTGCGCAGTGCCAGCTGCAGCAGTACGGCCCTTTGGCGTTCATCCTTGGCGACAGGACGACCAAAAAGCTGACAGAACGCAGCAGAGTGATAACCGTCGATGGCAATATATGTTCCGGGAAGAGCAAGCTTGCGAAGGTGGTAGCGGAGAAGCTAGGCTTGAGGTACTTTCCTGAAGCCGGGATCCATTATGCGGACAGCACCACGGGGGACGGAAAGCCGCTCGACGTGGAGCTCAGTGGCAACTGCAGCTTGGAGAAGTTCTACGACGACCCGAAAAGCAACGACGGCAACAGTTACCGCCTGCAGTCCTGGCTGTACGCCAGCCGCCTCCTGCAGTACGCCGACGCCTTGGAGCACCTGCTGAGCACAGGACAGGGCGTCGTGCTGGAACGCTCCATCTTCAGCGACTTCGTCTTCGTGGAGGCCATGTACAGCCAGCACTTCATCCGGAAGCAGTGTGTGAACCACTACTACGAGGTGAAGAAGGTCACCATCCGGGAGTACCTGCCCCCCCACGTGGTCATCTACGTCGACGTGCCCGTTCCAGAGCTCCAGAGCCGGATTCAGAAGAAGGGAGACCCACACGAGATGAAGATCTCCGCCGCCTACCTTCAGGCCATCGAGAATGCCTACAAGAAAACCTTCCTCCCTGAGATGAGTGAAAAATGCGAGGTCTTAGTGTATAGTGCGAATGAAGCTCAAGATGCGGAAAAGGTGGTGGAGGATATCGAATACCTCAAGTATGACAGAGGGCCGTGGCTCAACCAGGACGACCGTACCTTCCACATTCTGCGGATGCTGGTTCAGAATAAGTTGGAGGTGCTGAACTACACAACCATCCCGGTCTATCTCCCAGAAATCACGATCGGAGCTCACCAGAGTGACAGAGTCTTCCAGAAGTTCGTCGAGCTGCCAGGCCGCAGGTACAGCCCCGGGTACAACGCGGACGTGGGTGACAAGTGGATCTGGCTGAAGTGACGGCACGGCCTCCGCCAGAGCCGCTCCGTGGGACGCAGACGCCCGGCCGGCCGACCCGCACACTGTGGCTTTAGAACTGGGGGGAGTAGACGGTCCGAAATCGCAGGGTGCGGCAGCGGCACAGAGCAGGTGCCCGCAGGGTCGTCGGGGTGGGGGGACCTCGCCACCTCACTGTGGAGTAAGCACCGTTGTCGCGAGGGGAGCGCGGTCTGCGGGAGAGACGGGCGCCACCGGCACAGCCCCCCCGGCTCCCCTCGCGCTGTCGGGCACGTTTGTATGTCGCTCCCTCAGACTTGGAGAAATACAGCAGCTTCTGTGGCGCTTCTGTCCGTGGTGGCTCTGCTCACGCCGTGCGTGTCACACCGTCCGCACACGCACGCTCGCCGGTTCACCCACCGTCTGCCGGGCTGGGCCGTGCTTTAACTCGGACCTCCCTCCGTCGCGGCGGAGTTCCTCGAAGCACTTAGTCCGTTCGTCGCGGCCTCCTGCACGGGCAGAAAGGAGAGACAGCGCAGGGGACATAGCCAAAGAGGAGGAGGTCGCCATGGGAACCGCGTGTGTTTCCAGAGACGTTCTGGAAGCCTCGCGTGGTGGCCGCCATCGGCTGGTCATCTTCCTCTGACAGGCGGTTAGAATGTGGATGGGATAAAACGCAAGAGCAAAGCGACCCACGCTCTTCATCACCTAGAGATCAAGTGGTCACCGGAGGGGCGAGGGTGGGAGCCGTTTCTGTGCGGCCGCTGCCGAAGGCAGAAAGCGGGAGGCCGGGCCGGCGGGCGCCCGGGGAGCCCAGCAGCCTGCGCTGGGCCACACCCGGCTGTTGAATTAAATGAAGGAAAAGTAAACATGGCCTGAGGCGCAGCAACTCGGCCACACTAGCCGCTGTTCTGTGCGCAGTAGCCACACGGCCAGTGGCGTCAGTAGTGGACGGTGCGGGACGGT