Transcript asmbl_72561

Sequence
Transcript Sequence for observation asmbl_72561 of TGE0073895:
CCGGATTGGTAGTTGCTAGCAGGAGCCTGGTTTCTTCCTCGGTTTCTGCAAGTGATAGTGTGTGATTGGTTTAAATCCGCGGGCACCTGGCGGTGATTGGGCAGGGGCCACGGACGGGGTACGATCATTGGCCGGTGCTGGAACCAGCCCTTCTCGGGCGGGCAGCAAATGATGAAATGAGAACGGGGAGGGGAAAGGCCGCGACGTGAGCGCGCGACCTCCGGCGCCATTTTGTAGAGAAACAAGCGGAGTTAACCGAAGAGGGGGGTCGAGGAGAGCCGGAGTCGGGGACCCAGGAGTTTCCTGTGTCCAGCGCCACCGGAACCGCCTGAGGTTTTGTTCCACTCGCGCGCACGGGCGCTCACACTTTCTCCGAAGTCGGCCCCCACCCACTTGGCCCAGTGTCAGTGCTGTAGTGACGGTTCTGCTCACCTATGGGAAGTGTCCCCCTAGTGAACTGAGCACTTGGAGGCCTCAGTACTGGTGAGAGATTTACTGCAGGTCTTGTGAGGCTTACCGAAGGCCAACCACAATATTGAAATTTCACAAACTGAAGTATTTGCAGTACCACCCCTTCTGCAGAATTCACCCAACCGGGCTCACACAGGTGCCATGTTTCAGAACAGAGTAAGACCCCTGGTAAAGAAGAACTGAAGACACTGTATAGACACCAGATATAGGCTAATTACAAAGAAAGCATTAACCTGCCTCTGAGGTGACTAAAGGGGAATAATGGTGATTTTGCGCCGGGCTCGGCCGCCTGCTTCCGCCCCAACCAGCAATGAATCTTGACTCGCTCTCGCTGGCCTTGTCTCAAATCAGCTACCTGGTGGACAATTTAACCAAGAAAAACTACCGAGCCAGCCAGCAGGAAATACAGCATATTGTGAATCGGCACGGTCCTGAGGCAGACAGGCATTTATTACGCTGCCTATTTTCGCATGTGGATTTCAGTGGCGATGGTAAAAGCAGTGGCAAAGATTTTCATCAGACTCAGTTTCTGATTCAGGAGTGTGCGTCGCTGATTACAAAGCCAAATTTTATCTCCACGCTGTCCTATGCCATTGATAATCCATTGCACTATCAGAAGAGTTTAAAGCCTGCACCCCACTTATTTGCCCAGCTGAGTAAAGTTCTCAAGTTAAGCAAAGTACAAGAGGTAATTTTTGGCCTTGCCCTCTTGAATTCTTCCAGCTCAGATCTCAGAGGTTTTGCTGCCCAGTTTATCAAACAGAAGCTTCCAGATCTTCTGCGTTCTTACATTGACGCAGACGTCAGTGGAAATCAAGAAGGTGGCTTCCAAGATATAGCCATAGAGGTCCTACACCTCCTCCTCTCCCATCTCCTTTTTGGGCAGAAGGGAGCCTTTGGAGTTGGACAGGAGCAGATAGACGCTTTCCTTAAGACGCTGCGCAGAGATTTTCCCCAGGAACGCTGTCCTGTGGTGCTTGCACCACTTTTATACCCTGAAAAACGGGACATTCTAATGGACAGGATCCTGCCTGATTCTGGAGGGGTAGCTAAAACCATGATGGAGAGCTCTTTGGCTGATTTTATGCAAGAAGTAGGCTATGGCTTTTGTGCAAGTATTGAAGAATGTCGCAATATAATCATGCAATTTGGTGTTCGGGAAGTCACAGCTGCCCAGGTTGCAAGGGTTTTGGGAATGATGGCTCGAACTCATTCAGGATTAACAGATGGAATTCCATTACAGAGTATCTCTGCTCCTGGCAGTGGGATCTGGAGTGATGGAAAAGATAAAAGTGATGGAGCACAGGCACACACGTGGAATGTAGAAGTCTTGATTGATGTTCTCAAAGAACTGAACCCGAGTTTGAATTTCAAGGAAGTAACTTATGAACTGGACCATCCTGGATTTCAAATTCGTGACAGTAAAGGACTTCATAATGTGGTTTATGGCATTCAAAGGGGTCTGGGAATGGAAGTGTTCCCAGTAGACCTCATATATAGACCTTGGAAACATGCAGAAGGCCAGCTCTCCTTCATTCAGCATTCCCTTATAAATCCAGAGATCTTCTGTTTTGCTGACTATCCCTGTCATACTGTTGCCACTGATATTCTGAAAGCACCACCAGAGGATGACAATCGAGAAATTGCCACATGGAAGAGCTTGGATTTGATTGAATCTCTACTGAGGCTCGCAGAGGTGGGGCAATATGAGCAAGTCAAACAGCTCTTCAGCTTTCCTATCAAACACTGTCCAGACATGTTGGTATTGGCCTTACTACAAATCAACACCTCCTGGCACACCTTGCGCCATGAGCTCATCTCCACTCTGATGCCAATTTTCCTCGGAAACCATCCTAACTCTGCTATTATTTTGCACTATGCATGGCATGGGCAGGGACAGTCTCCCTCAATCCGCCAGCTTATCATGCATGCAATGGCAGAGTGGTACATGCGAGGGGAGCAGTATGATCAGGCCAAATTGTCTCGAATACTTGATGTGGCCCAGGACTTGAAGGCCTTGTCAATGCTGCTAAATGGTACTCCATTTGCCTTTGTTATTGACCTTGCTGCACTTGCTTCACGTCGTGAATACCTCAAACTTGACAAGTGGCTCACAGATAAAATTCGAGAGCATGGAGAGCCTTTTATCCAGGCATGCATGACTTTTTTAAAGAGACGGTGCCCTTCTATTTTGGGTGGACTCGCCCCAGAGAAAGATCAGCCCAAAAGTGCTCAACTTCCTCCAGAAACTCTGGCGACAATGTTGGCCTGTTTACAAGCTTGTGCAGGGAGTGTTTCTCAGGAGTTATCAGAAACCATCCTCACCATGGTAGCCAATTGCAGTAATGTTATGAATAAGGCCAGACAACCGCCACCTGGAGTTATGCCAAAAGGACGCCCTCCTAGTGCTAGCAGCTTAGATGCCATTTCTCCTGTTCAGATTGACCCTCTAGCTGGAATGGCATCTCTTAGTATAGGTGGTTCAGCTGCCCCTCACACCCAGAGTATGCAGGGTTTTCCACCAAATTTGGGTTCTGCATTCAGTACCCCTCAGTCACCAGCAAAAGCATTTCCACCCCTTTCTACCCCAAATCAAACAACTGCATTCAGTGGTATTGGAGGACTTTCATCACAGCTCCCAGGTGGTCTTGGCACAGGCAGCCTGACTGGTATAGGAACTGGGGCTCTTGGACTCCCTGCAGTGAATAACGATCCTTTTGTACAGAGGAAACTGGGCACCTCTGGACTGAACCAGCCTACATTCCAGCAGAGTAAGATGAAACCTTCGGACTTGTCTCAGGTGTGGCCAGAGGCAAACCAGCACTTTAGTAAAGAGATAGACGATGAAGCAAACAGCTATTTCCAGAGAATATATAATCACCCACCACATCCAACTATGTCTGTTGATGAGGTATTAGAAATGCTACAGAGGTTTAAAGACTCTACCATAAAGAGAGAACGAGAAGTATTTAATTGTATGCTAAGGAACTTGTTTGAAGAATATCGGTTTTTCCCCCAGTACCCTGATAAAGAGTTACATATAACAGCCTGCCTGTTTGGTGGGATAATTGAAAAAGGACTGGTCACTTACATGGCACTAGGTCTGGCCCTGCGATATGTTCTTGAAGCCTTACGCAAGCCTTTTGGATCCAAAATGTATTATTTCGGGATTGCTGCACTAGATAGATTTAAAAATAGATTGAAGGACTATCCCCAGTATTGTCAGCACTTGGCTTCTATCAGTCACTTTATGCAGTTTCCACATCATTTACAGGAGTATATTGAGTATGGACAGCAGTCTAGAGATCCTCCTGTGAAAATGCAGGGCTCCATCACAACACCCGGAAGTATTGCACTGGCTCAGGCTCAGGCTCAGGCCCAGGTTCCAGCAAAAGCACCCCTTGCTGGTCAGGTTAGCACTATGGTAACCACCTCAACAACCACCACTGTTGCTAAAACGGTTACAGTCACCAGGCCAACTGGAGTCAGCTTTAAGAAAGATGTGCCACCTTCTATTAATACTACAAATATAGATACATTGCTTGTGGCCACAGATCAAACTGAAAGAATTGTAGAGCCCCCAGAAAATATCCAGGAGAAAATTGCATTTATCTTCAACAATCTCTCACAGTCGAATATGACACAAAAGGTTGAAGAACTCAAGGAAACTGTGAAGGAAGAATTTATGCCTTGGGTTTCACAGTACCTGGTTATGAAGAGAGTCAGTATTGAGCCAAACTTTCACAGCTTGTATTCAAACTTCCTTGACACGCTGAAGAATCCTGAATTTAATAAGATGGTTCTAAATGAGACCTACAGAAACATCAAAGTTCTCCTGACCTCTGATAAAGCTGCAGCCAATTTCTCAGATCGTTCTTTGCTGAAGAACTTGGGACATTGGCTGGGAATGATTACACTAGCTAAAAATAAACCCATCTTACATACTGACTTGGATGTGAAATCTTTGCTGCTAGAGGCTTACGTTAAAGGACAGCAAGAATTGCTCTATGTAGTACCCTTTGTTGCCAAAGTCTTAGAGTCTAGCATTCGTAGTGTGGTTTTTAGGCCACCCAACCCCTGGACAATGGCAATTATGAATGTATTAGCTGAGCTACATCAGGAACATGACTTAAAGTTAAACTTGAAGTTTGAGATTGAGGTCCTCTGCAAGAACCTTGCATTAGACATCAATGAGCTAAAACCTGGAAACCTCCTAAAGGATAAAGATCGCCTAAAGAACTTAGATGAGCAACTCTCTGCTCCAAAGAAAGATGTCAAACAGCCAGAAGAACTCCCTCCCATCACAACCACAACAACTTCTACGACACCAGCTACCAGTACCACCTGTACAGCCACGGTTCCACCACAGCCACAGTACAGCTACCATGACATCAATGTCTATTCCCTCGCAGGCCTGGCACCACACATTACTCTAAACCCAACAATTCCCTTGTTTCAGGCCCATCCGCAGTTGAAGCAGTGTGTGCGTCAAGCAATTGAACGGGCTGTCCAGGAGTTGGTCCATCCTGTGGTGGATCGATCAATTAAGATTGCCATGACTACTTGTGAGCAAATAGTCAGGAAGGATTTTGCCCTGGATTCTGAGGAATCTCGAATGCGAATAGCAGCTCATCACATGATGCGTAACTTGACAGCTGGCATGGCTATGATTACTTGCAGGGAACCTTTGCTCATGAGCATATCTACAAATCTGAAAAACAGTTTTGCCTCAGCTCTTCGTACTGCATCCCCACAACAAAGGGAAATGATGGATCAGGCAGCTGCTCAGTTAGCTCAGGACAATTGTGAATTAGCCTGCTGTTTTATTCAGAAGACTGCAGTAGAAAAAGCAGGCCCTGAGATGGACAAGAGATTAGCAACTGAATTTGAGCTGAGAAAACATGCTAGGCAAGAAGGGCGCAGGTACTGTGATCCTGTTGTGTTAACATACCAAGCTGAGCGGATGCCAGAGCAAATCAGATTGAAAGTTGGTGGTGTGGACCCAAAGCAGCTGGCTGTTTATGAAGAATTTGCACGCAATGTGCCTGGCTTCTTGCCTACTAATGATTTAAGTCAGCCCACGGGATTTTTAGCTCAGCCTATGAAGCAAGCTTGGGCAACAGATGATGTAGCTCAAATTTATGATAAGTGCATTACAGAACTGGAGCAGCACCTACATGCCATCCCACCAACATTGGCCATGAACCCTCAAGCTCAGGCTCTGAGAAGTCTTTTGGAGGTTGTAGTTTTATCTCGAAACTCTCGGGATGCCATAGCTGCTCTTGGATTGCTCCAGAAGGCTGTAGAGGGCTTACTAGATGCCACAAGTGGTGCTGATGCTGATCTGCTGCTGCGCTATAGGGAATGCCACCTCTTGGTCTTAAAAGCTCTTCAAGATGGCCGTGCATATGGGTCTCCGTGGTGTAACAAACAGATCACAAGGTGCCTAATTGAATGTCGAGATGAATATAAATATAATGTGGAGGCAGTGGAGTTGCTAATTCGCAATCATTTGGTTAATATGCAGCAGTATGATCTTCACCTAGCTCAGTCAATGGAGAATGGTTTAAACTACATGGCTGTGGCATTTGCTATGCAATTGGTAAAAATCCTGCTGGTGGATGAAAGGAGTGTTGCCCATATTACTGAGGCAGATCTGTTCCACACCATTGAAACCCTCATGAGAATTAATGCTCACTCCAGAGGCAATGCTCCAGAAGGATTGCCCCAGCTGATGGAAGTAGTGCGATCCAACTATGAAGCAATGATTGATCGTGCTCATGGAGGCCCTAACTTTATGATGCATTCTGGGATTTCTCAAGCCTCAGAGTATGATGATCCTCCAGGCCTGAGGGAGAAAGCAGAGTACCTTCTGAGGGAATGGGTGAATCTCTACCATTCAGCAGCAGCTGGCCGTGACAGTACCAAAGCTTTCTCTGCGTTTGTTGGACAGGTAGAGCTTTTGGAAAGAAAGATGCACCAGCAAGGAATCCTGAAGACTGATGACCTCATAACAAGGTTTTTTCGTCTGTGTACTGAAATGTGTGTTGAAATCAGTTACCGTGCTCAGGCAGAGCAGCAGCACAATCCTGCTGCTAATCCCACCATGATCCGAGCCAAGTGCTATCACAACCTGGATGCCTTTGTTCGACTCATTGCACTGCTAGTGAAGCACTCAGGGGAGGCCACCAACACTGTCACAAAGATTAATCTGCTGAACAAGGTCCTTGGTATAGTAGTGGGAGTTCTCCTACAGGATCATGATGTTCGGCAAAGTGAATTTCAGCAGCTTCCCTACCATCGAATATTTATCATGCTGCTCTTGGAACTCAATGCACCTGAGCATGTACTAGAAACCATTAATTTCCAGACACTTACAGCTTTCTGCAATACATTCCACATCTTGAGGCCTACCAAAGCTCCAGGCTTTGTGTATGCCTGGCTCGAACTGATCTCCCATCGGATATTTATTGCAAGAATGCTGGCACATACGCCACAGCAGAAGGGATGGCCTATGTATGCACAGCTACTGATTGATTTATTCAAATATTTAGCACCTTTCCTTAGAAATGTGGAACTCACCAAACCTATGCAAATCCTCTACAAGGGCACTTTAAGAGTGCTGCTGGTTCTTTTGCATGATTTCCCTGAGTTCCTTTGTGATTACCATTATGGATTCTGTGATGTGATCCCACCTAATTGTATCCAGCTAAGAAATCTGATACTGAGTGCCTTCCCAAGAAACATGAGGCTCCCAGACCCATTTACTCCCAATCTGAAGGTGGATATGTTGAGTGAAATTAATATTGCGCCCCGGATTCTCACCAATTTTACTGGAGTGATGCCACCTCAGTTCAAAAAGGATTTGGATTCCTATCTTAAAACTCGATCACCGGTCACTTTTCTATCTGATCTGCGCAGCAACTTACAGGTGTCCAATGAGCCTGGCAATCGCTACAACCTCCAGCTCATCAATGCACTGGTGCTCTATGTAGGGACTCAGGCCATTGCACACATCCACAACAAGGGCAGCACACCTTCAATGAGCACGATCACCCACTCGGCTCACATGGACATATTCCAGAACCTGGCTGTGGACTTGGACACTGAAGGCCGGTATCTCTTTTTGAATGCAATTGCAAATCAGCTGCGGTACCCAAATAGCCACACTCACTACTTCAGCTGCACCATGCTGTATCTCTTTGCAGAGGCCAACACTGAAGCTATCCAAGAACAGATCACAAGGTAAGAGAGGGTTTGCTTTTCAGATGCTTCTGAGTGGTACCTCTTATGAATTTGGTTTTACTGTGCATTTCAGTGTTCATTGAGCATCTTTTATGTGTTACAAATGTAGGATGTGGGGGACATGGTTCCTGCCCTCTTATATTAAGTCTGATGGTCACAAAAATATCACTGGTAGAGAATTACAAATCATAATCGTTGCTGAAATAAAGTATTCATTGGAAGGCACCAGCATTTTGATTGAAGGTTGGGAATTTCTCCCAGGTGGTGGCGGCAGCACTTTTAACCAGTGTGAATCATACAGGCTTATTAAAGCCCATGTTAAAGAGCTTGGACATGGTTTTCTTCATTACCTCTATGTTGAAACGTTTTAAGCAGAACAAGGTCATACTTGTGTTTTCCTAATGATAGTTAGGAATCTGCTGCAGATTGCTTGGACTGTACACAGCATTAGAGATTAGGAAATGGGTAGATTCTAGTGAGAGAATACTTTAAAAACTAGACATAGTTTGCGGGAATTAGATAACGGTGTTTCTATTGGATGTTTAGATGATAATGTCTTATCTTGTGATTATATAGTAAACTTCCTTGTACTTAAAATCTTTTATTCTTTAGGGTAAATTTAGAGGTACAGTTGGCTAGGTCATCACTAACTGCCATTCAAAAAAATTACCACCAATTTATACATGTACTAGTAGCACTAGAATATGTTGTACCATGTAATCTTATGTTGTCTTTATTTTACCTTACTTAGTTTTCTGGGCTTAGTAATAGGAAGAGGGGGATTCAAACCCACGTTTTCTAATTCTAGAATCCACTTGCATTAAACATGCTATATGGAATATAGAGATTAATCTGTTTTTAGTAAAGGGTAAATGGTCACGGATGTGTTTCTCTGTAAATTCACTAACTTCTCTCCTTCCCCAGG