Transcript asmbl_70781

Sequence
Transcript Sequence for observation asmbl_70781 of TGE0004100:
CTCAGTCGCTGTGGGCGGTGGCGGGCGGCGGGGTTAAGCGCGTCGCCGTACCCGGGCCTAGGCGCGAGCCCGGAGCGCTGAATCCGCGCTTCGGCCCCGGAGCCGCGGTCTCCCGCCATGGGTCTCTGTCTCTTCCTCTACCGCGCACCCCTGCTTCTGTGGGGCCTACTGTTTCTCCTGCTGCTTGCAGTCTCGGCTCTCCAGGCTGGACGTCCGTCCCCTGTGGTCCTGGTGCCTGGTGATTTGGGCAACCAGCTGGAGGCAAAGCTGGACAAGCCAAAGGTCGTGCACTACCTCTGCTCCAAGAAAACAGACAGCTACTTCACACTCTGGCTGAACCTTGAACTGCTGCTGCCTGTCATCATTGACTGCTGGATCGACAATATCAGGCTGGTGTACAATAGAACGTCCCGGACCACCCAGTTTCCTGATGGTGTGGATATGCATGTCCCTGGCTTTGGGAAGACCTTTGCACTGGAGTTTCTGGACCCCAGCAAAAGCAGTGTGGGTTCCTATTTCCACACTATGGTGGAGAGCCTTGTGGGCTGGGGCTACACACGGGGTAAGGATGTCCGGGGGGCCCCCTATGACTGGCGCCGAGCCCCAAATGAAAACGGGCCCTACTTCCTGGCCCTCCGGGAGATGATCGAGGAGATGCATCAGCTGTATGGGGGCCCCGTGGTGCTGGTTGCCCACAGTATGGGCAACATGTACACGCTCTACTTTCTGCAGCGGCAGCCACAGGCCTGGAAGGACAAGTACATCCGTGCCTTCTTGGCACTGGGTGCGCCTTGGGGGGGCGTGGCCAAGACCCTACGCGTTCTGGCCTCAGGAGACAACAATCGGATCCCGGTCATTAGTCCCCTGAAGATCCGGGAGCAGCAGCGATCTGCTGTCTCTACCAGCTGGCTCCTGCCCTATAACTATACCTGGTCACCTGAGAAGGTCTTCGTGCGCACACCCACGGCCAACTACACGCTGCGCGACTATCACCGGTTCTTCCAGGACATTGGCTTTGAAGATGGCTGGCTCATGCGGCAGGACACGGAAGGGCTGGTAGATGTCACAATGCCACCTGGCGTACAGCTGCACTGCCTCTATGGCACTGATGTCCCCACGCCGGACTCCTTCTACTATGAGAGCTTCCCGGACCGCGACCCTAAAATCTACTTTGGCGATGGTGATGGCACTGTGAACTTGCAGAGTGCCCTGCATTGCCAGACCTGGCGCAACCACCAGGCACACCAAGTATCATTGCAGGCGCTGCCAGGCAGTGAGCATATTGAAATGCTGGCCAATGCCACCACTCTGGCCTATCTGAAACGCATGCTCTTTGGGCCCTGATTCCTGTCCCAGCCAGGGCTGCGCGATGGCTCGGCTACAGCTGCTTCTCTTGGACTCTGGGGCTGCGATGGCCCATGAGTTTAGCAGTTTGTGACTGACCATCCAAGGTCCTGAGTCTTTGGTTGTGAAACATCTTCCATATGAAGTGCTGTTTCTTATCCTTTCTCTGGGAGGGAGGAAGGAAGAAATAGTCTAGACTCACTTGAGGGACCCTTAATGGAAAGAATGCTGCTGCTGATGGAATTGTGACCTCAGGACTGGCTCTGCAGGTGGATTGGCTGGCACCTGGATCCAATCCCCAACTCAGGGGCCATGTGTTCCTCCTATGCCTGTGGCCTTTTCACATTTACCCACCAGGCCTGGCCCCTCAGCCTTCCTGTAAGTGATATGACTAAGCTGTGGTTCCTACCCCCACAGGCCCCAGGAATGGGCTCCTGGTCCCTAGGGTGACCCTTCCCACACACTGGCCACAGGTGAGCCTACTACTGGCCATGGGTGGCTGGAGCTGCTGGCTTCCTTGTAGCATAGCTGCTTGACAGTCTGACTGGCTTTCTGAGGGCAGTCCAGTTTCCCCTGCAGGCAGGGGCAGATTGTTGTGTTCTCTGTGGTTCTCAGGCTCTGGGGCATTCACTCTTACCTCCCTCACCTCTAAAAACAGCCTAGCTCAGGATTGGGCAGCAGATGGCCCCTTAGTTCTGCAGCCATGGCCCAGGAGCTCTGATCCCCTTGGTCGGGCTGTTTCCCACAGTACTGATGTTAGCTTCCTTTACCTTGGGACTATGGTTCAAGGATAAGAGCAGGGCCCAGTGCCATGGCCTTTTAGGTCCTCATGAAGAAAGAAAACTTAAGGACACAGACAAGATGATTCGGAGTTTCTCTGAACTGCCCTCTTGCTAACTCTACCACCATACTGCCACCCTTCCCCACGGTTTCTCTAGTACCCAAGTGGGCTGGCACAGAGTCGAAAGGAGACAGGGCTTCTGCCCATCCTGCCCAGCACATACCTCCACCAGGCAGCTCAGTGGTGTTTAGTCTGCAGGGACAGCTCAGAACATACTTTGGGACCCTGTGAGACCCAGGTGCCTTGGAGCCCCCTTGGGGGTTTCTGTCTGCCTCAGAGGTGCTGCATGAGTCTCCTTGTGATAGCAGGGCTGGAGAATCTGGATTTACCTTGGTGGCAGTGGTCTCCAAGTAGGCGACAGCTATAAGCCAAGACTTGGGTCTAGCCTCTAGGGTGAGGCCCCAAAGCCACAGTCAGACTAGACTGTGCTGTTCTCCCACAAGATTTCTGTGGAGCCGGATTTTCTCTGTTGTGTACATACCCAGCATCTGTCTCTCCCTTTGTTTCTGAGTGGTGGGCCTCACCTGCATGGGGCTCTGAGCAGGCTGTACCTCGATTCTGGCAATAAAAGTATTCTGGATACTGTAAAGTACCTTGAGAGGTGGGAAGTGGTGGGGGGGTAAAGGGGCTAGAGAAGCAGGTAGTCAGGCGAGGCCTTTTCTGGAGCCTTGATGGGTTCTCAACACCAAAGCATGGCTCCTATGCACCACTTTGGGCTTTATCCTTCTGCCGCCTCTTCTGGAATCTATTTTCCCTCCTGGTACATAGAACCAGGAACTGAAACATTCCTGTTGGAATGAAGCTCCTGCTCCTGCCTGATCAGCAGGGCCTACATGCCACCCCCGAGCTAGGTACCAGGACAATCCTGTGGGTCACCCTGGCTGGACTCTCTAGCTTTCTCTCTCTCAGCTAGCAGGTCTCAGCATCCTTTGAACCTAGAGTTCTTTTCAGGACACCACCCTTCTTTGTTTCAGCTTCTCTACCCACCATCTGTTCTGCTTTGGAGACAGAGTGAGACGGAGGGAGGAAGAGATCCTAGGCTGAGACTGGTATGGACAGAGGCCAAGATGGATAGACAGAAACAGAGTCTGAAACAGGGAAGCATGCATGGAGATGGAGTCCAGGCCTGAATTCTATGGTGCAGAGCCCAGAGCCGAGGCCAGTCGGGGTGG