Transcript asmbl_70719

Sequence
Transcript Sequence for observation asmbl_70719 of TGE0004098:
CCGGGAGCCAAAGATCGGGCGGGCCGGAAGTGGAGGCGGTTGGTGAAGTTGGAGGGGCTCAGGGACGCGGTGCGGGCCGCGGTTTGTGGGCTGCGGGTGGTGACCAGCATCCTGCTGTCTGGCCCCGGTGCGGCTGTACTCGGCTGGATAGTGCGCAGCGGCAGCGACACGAACCCGGCGCGGACAGGGCGCCCGTGGCTGGGCCCATGGCCTCCTGCGCGAGCATCGACATCGAGGACGCCACGCAGCACCTACGGGACATCCTCAAGCTGGACCGGCCCACGGGGGGCCCCAGTTCAGAGAGCCAACGGCCATCTAACGCCTACAATGGGGACCTCAATGGACTCCTGGTCCCAGACCCCCTCTGCTCAGGTGATGGTACTTCAGCAAACAAGCCTGGTCTCCGGGCCATGCCACCTATTAACCTGCAGGAGAAGCAGGTCATCTGCCTTTCAGGAGATGACAGCTCTACCTGCATTGGGATTTTGGCCAAGGAGGTGGAGATTGTGGCCAGCAGTGACTCTAGCATCTCGAGCAAGGCACGAGGGAGCAACAAGGTGAAAATCCAGCCTGTTGCCAAGTATGACTGGGAGCAGAAATACTACTACGGCAACCTGATTGCTGTGTCCAACTCCTTCTTGGCCTATGCCATTCGGGCTGCCAACAATGGCTCAGCGATGGTGCGGGTGATCAGCGTCAGCACTTCGGAACGGACCTTACTCAAGGGCTTCACAGGCAGTGTGGCTGACCTGACCTTTGCACACCTCAACTCTTCACAGCTGGCCTGCCTGGATGAGGCAGGCAACCTGTTTGTGTGGCGCTTGGCTCTGGTTAATGGCAAAATTCAAGAAGAGATTTTGGTTCATATCCGGCAGCCAGAGGGTACACCACTGAACCACTTTCGTAGAATCATCTGGTGCCCCTTCATCCCTGAGGAGAGTGAGGATTGCTGTGAGGAGGGCAGCCCAACGGTGGCCCTGTTGCATGAAGACCGGGCTGAGGTGTGGGACCTAGACATGCTCCGCTCCAACCACAGCACCTGGCCTGTGGATGTCAGCCAAATCAAGCAGGGCTTCATTGTGGTGAAAGGCCATAGCACATACCTGAGTGAAGGGGCCCTCTCACCTGATGGGACTGTCCTGGCCACTGCAAGCCATGATGGCTTCATCAAATTCTGGCAGATCTACATTGAGGGGCAGGATGAGCCAAGGTGTCTGCACGAGTGGAAGCCTCATGATGGGCGGCCCCTTTCCTGCCTCCTATTCTGTGACAACCACAAGAAACAGGACCCTGATGTCCCTTTCTGGAGGTTCCTCATTACTGGCGCTGACCAGAATCGGGAGCTGAAGATGTGGTGCACAGTGTCCTGGACCTGCCTGCAGACTATTCGCTTCTCCCCAGATATCTTCAGCTCAGTGAGTGTTCCCCCTAGCCTCAAAGTTTGCCTGGACCTCTCAGCAGAATACCTGATTCTCAGTGATGTGCAACGGAAGGTCCTCTACGTGATGGAGCTGCTGCAGAACCAGGAGGAGGGCCGTGCCTGCTTCAGCTCCATCTCTGAGTTCCTGCTTACCCACCCTGTCCTGAGCTTTGGTATCCAGGTCGTGAGTCGCTGCCGACTGCGGCACACTGAGGTGCTGCCTGCCGAGGAAGAGAACGACAGCCTAGGGGCTGATGGGACCCACGGAGCTGGTGCCATGGAGTCTGCAGCTGGTGTGCTCATCAAGCTCTTCTGTGTGCATACTAAGGCTTTGCAAGATGTGCAGATCCGCTTTCAGCCACAGCTAAACCCTGATGTGGTGGCCCCGCTCCCTACCCACACTGCCCATGAGGACTTTGCATTTGGAGATTCTCAGCCTGAACTGAGCTCCGGGGGGCTGGGATCAGCTGCTCATGGCTCCCAGCCTGACCTCCGACGCATTGTGGAGCTGCCTGCACCTGCTGACTTCCTTAGTCTGAGCACTGAGACCAAGCCCAAGCTGATGACACCTGATGCTTTCATGACATCTAGCACCTCCCTGCAGCAGATCTCTGCATCCCCTAGTAATAGCAGCGGCGGCAGCAGCAGTGGTAGCAGCAGCAGCAGCAGCAGCTCCTCTCTTACAGCTGTGTCTGCCATGAGCAGTACCTCGGCTGTGGACACCTCCTTGTCCAGGCCCCCTGAGGAGCTGACCTTGAGCCCCAAGCTGCAGCTGGATGGCAGTTTGACAATGAGCAGCAGTAGCAGCCTGCAGGCAAGCCCACGCAGCCTCCTGCCCGGCCTGTTACCAGGTCCAGCTGACAAATTGACTCCCAAAGGGCCTGGGCAGGTGCCTACTGCTGCCTCTGGACTGTCCCTGGAGCTGCAGGAAGTGGAGCCCCTGGGGCTACCCCAGGCTTCCCCTAGCCGTACTCGCTCCCCTGATGTTATTTCCTCAGCTTCCACTGCCCTGTCCCAGGATATCCCTGAGATCGCGTCTGAGGCCCTGTCCCGTGGCTTTGGCTCCTCTGCTCCTGAGGGCCTTGAACCGGACAGTATGGCCTCAGCTGCTTCAGCACTACACTTGCTGTCCCCACGGCCACGGCCCGAGCTTGGGCCCCAGCTTAGCCTGGATGGAGGCCCTGGGGATGGGGATCGGCATAGTACCCCTTCCCTCCTGGAGGCAGCCTTGACCCAAGAGGCTACAGCCTCTGACAGTCAGGTCTGGCCAACAGCACCAGACATTACTCGGGAGACCTGCAGCAGCCTGGCAGAAAGCCCTAGGAATGGCCTTCAGGAAAAGCACAAGAGCTTGGCCTTCCACCGACCGCCTTATCATCTGCTGCAGCAACATGACAGCCAGGATGCCAGTGCTGAACAAAGTGACCATGATGATGAGGTGGCCAGCATTGCCTCTGCTGCAGCGGGCTTTGGCACCAAAGTTTCCACTCCACGGCTTCCTGCCAAGGACTGGAAGACCAAGGGATCTCCTCGGGCCTCACCTAAGCTCAAGAGGAAGGGCAAAAAGGATGATGGGTAGGAGGGGTCCTGGGGCCAGGGAGAGGGGTGGTCCCCAGGCTGTCTAGGCCTGAGGTGCTTCTCGCCTGTGGCAGGGATTCGACTGCGGGATCCCGGCTCATGGAGCACCAGGTGACAGAGCCCCCTGAGGATTGGCCTGCAATAATTTGGCAACAGCAGAGAGAGCTGGCAGAGCTGCGGCACAGCCAAAAAGAGCTACTGCAGCGTCTGTGCACCCAGCTCGAAGGCCTGCAGAGTACCGTCACAGGCCATGTAGAACGTGCCCTCGAGTCCCGGCATGAACAGGAGCAGCGGCGGTTGGAGCGGGCACTGGCAGAAGGGCAGCAGCGGGGTGGGCAGCTACAAGAGCAGCTGACGCAACAGCTGTCACAGGCACTGTCTTCAGCTGTGGCTGGGAGGCTGGAACGCAGCATACGGGATGAGATCAAGAAGACAGTGCCTCCATGTGTCTCTAGGAGTCTGGAACCCGTGGCAGGCCAACTGAGCAACTCAGTGGCCACCAAACTCACAGCTGTGGAGGGTAGCATGAAAGAGAATATCTCCAAGCTGCTGAAGTCCAAGAACTTAACAGACGCTATTGCCCGAGCAGCTGCAGACACGTTACAAGGGCCAATGCAGGCTGCCTACCGTGAAGCCTTCCAGAGTGTGGTGCTGCCTGCCTTCGAGAAGAGCTGCCAGGCCATGTTCCAACAGATCAATGATAGCTTCCGACTGGGCACACAGGAATACTTGCAGCAGCTAGAGAGCCACATGAAGAGCCGGAAGGCACGAGAACAGGAGGCGCGGGAGCCTGTGTTGGCCCAGCTGCGGAGCCTGGTCAGCACACTGCAGGGTGCCACTGAGCAGATGGCAGCCACTGTGTCTAACAGTGTTCGGGCTGAGGTGCAACACCAGCTGCATGTGGCTGTGGGCAGCCTGCAGGAGTCAATTTTAGCACAGGTACAGCGCATTGTTAAGGGTGAGGTGAGTGTGGCACTCAAGGAGCAGCAGGCCTCCGTCACCTCTAGCATCATGCAAGCCATGCGCTCAGCTGCAGGCACACCTGTCCCAGCTGCCCACCTCGACTGCCAGGCCCAGCAAGCCCATATCCTGCAGCTGCTGCAGCAGGGCCACCTCAATCAGGCCTTCCAGCAGGCCCTCACGGCTGCTGACCTGAACCTGGTGCTGTATGTGTGTGAAACTGTGGACCCAGGCCAGGTTTTTGGGCAGCCACCCTGCCCACTCTCCCAGCCCGTGCTCCTTTCCTTCATCCAGCAGCTGGCCTCTGACCTTGGCACTCGAACTGACCTCAAGCTCAGCTACCTGGAAGAGGCTGTGATGCACCTGGACCACAGTGACCCCATCACTCGGGACCACATGGGTTCCGTCATGGCCCAGGTGCGCCAGAAGTTATTCCAGTTCCTGCAGGCTGAGCCATACAACTCACTTGGCAAAGCGGCCCGGCGTCTTAGCCTCATGTTGCATGGCCTTGTGACCCCCACCCTCCCTTAGCAAAGCCTGCCTTGCCCAGGGGTGCAGTGGCATTGAAGACCAGCAGACAGGCCTAGACCAAAGCAGGGTCATGTCTGCCCTTTATCTGCTCAGGCTCCCACCTCTGGGGTAGTTGAGAGGGGGAACACTGGCTGTAGTCTACAGGTTATGGTAGCCAGCAGGTTTAGGCTGAGCCCAGGGTGGGTATTGTGCCTTCTTGGGTTCTGCCATGCCTGGAGCATGACCCCCTGAGATTGTGATACCACTTGAGTTGAATTTTCCATGTTCCTTTTTACCTCTGTTTTGGATCTTTCTGTTTTTGAAAAACATTGAGAAATTCAATTAAATGCTTTTGG