Transcript asmbl_62458

Sequence
Transcript Sequence for observation asmbl_62458 of TGE0006784:
TTTGTGAAGCGGCGGAGGAGGTGGTGGCTGCTGTGGGCTCCGGGAAGCTGTTCGCGCAGGGGCTGTCGGCCGCGGGGCGAAGGCACTCGCGCGGGGGGTAACTCGGGTCTGGGTTCAGGTGCCGCGCAGCTCTCCCCGGATTGACTTGGCCTCTACTTCTTGTTAAGAAAATACATCTCTTGTTTTATCAGATGGCCCGCTGCGTGACCTTGGTTCAACTGTCCATTTCCTGTGACCACCTCATCGATAAGGACATCGGCTCCAAGTCTGACCCACTCTGTGTCCTTTTACAGGATGTGGGAGGGGGCAACTGGGTTGAGCTTGGCCGAACTGAGCGAGTACGGAACTGCTCGAGCCCTGAGTTCTCCAAGACTCTGCAGCTTGAATATCACTTTGAAACAGTCCAGAAGCTCCGATTTGGCATCTATGACATAGACAACAAGACACCTGAGCTGGGGGATGACGACTTCTTAGGTGGGGCTGAGTGTTCCCTAGGACAGATTGTGTCCAGCCAGATAATAACTCTGCCTTTGATGCTGAAGCCTGGAAAACCTGCTGGGCAGGGGACCATCACGATCTCATCTCAGGAATTGAAGGATAGTCGTGTAGTGACCATGGAGGTGGAAGCCAGAAACCTAGATAAAAAGGACTTCCTGGGGAAATCTGATCCATTCTTGGAGTTCTTCCGCCAGGGTGATGGGAAATGGCACCTGGCATACAGATCTGAGGTAATCAAGAACAACCTGAACCCTGCATGGAAGCGCTTCTCTGTTCCCCTTCAGCATTTCTGTGGGGGAGACCCTAGCACACCTATCCAGGTACGATGCTCAGACTATGACAGTGATGGTTCACATGATCTCATTGGTACCTTCCACACCAGTTTGGCCCAGCTGCAAGCAGCCCCAGCTGAGTTTGAATGCATCCACCCTGAGAAACAGCAGAAAAAGAAAAGCTACAAGAACTCTGGAACTATTCGTGTCAAGATTTGCCAGGTAGAAACAGAGTATTCATTCCTCGACTATGTGATGGGAGGCTGTCAAGTCAACTTTACTGTGGGTGTGGACTTCACAGGCTCCAATGGAGACCCCTCCTCACCAGACTCCCTGCACTACCTGAGCCCAACAGGGGTCAACGAGTACCTGACAGCACTGTGGAGTGTGGGAAGCGTGATTCAGGACTATGATTCGGACAAGCTGTTCCCAGCATTTGGATTTGGGGCTCAAGTGCCCCCTGACTGGCAGGTCTCCCATGAATTTGCTTTGAACTTCAATCCCAGTAACCCCTACTGTTCAGGCATCCAGGGTATTGTGGATGCCTACCGTCAGGCCCTGCCCCAAGTTCGCCTCTATGGCCCCACAAATTTCGCACCCATCATCAACCATGTGGCCAGGTTTGCAGCCCAGGCTGCACAACAGAGGACTGCCTCGCAATACTTTGTGCTGCTGCTGCTAACCGACGGTGCTGTGACAGATGTGGAGGCCACACGTGAGGCTGTGGTTCGTGCCTCCCACCTGCCTATGTCAGTGATCATCGTGGGTGTGGGCGGTGCTGACTTCGAGGCCATGGAGCAGTTGGATGCTGATGGTGGACCCCTGCGCACACGCTCCGGGGAGGGAGCTGCCCGTGACATAGTGCAGTTTGTGCCCTACCGCCGCTTCCAGAATGCCCCTCGAGAGGCATTGGCGCAGACTGTGCTCGCAGAGGTACCCATGCAACTGGTCTCCTACTTCAAGGCCCAAGGCTGGGCCCCATTCAAGCCGCTTCCACTCCCAGCCAAGGGCCCTGCAGAGGCTCCTCAGGCCTAGATTCCCTTGGAGCGTAGGTTATGGCCAGTCCTCAGCCCTGTGTCCCCACCTCTGAACACACTTGCCAGTGCTAGCAGTTTATATATTTTATACTTTTATACTTGCTCCTGCTATTGCTGCTCTTGATCCCACCTGCTTGCCCCCTGGAGCCCTTCATTCAATAAAGATCAACGATGACCACT