Transcript asmbl_67393

Sequence
Transcript Sequence for observation asmbl_67393 of TGE0003993:
CAGAAGGCCGCGGGGCAGCAGCGCGCGCCTGCGGGAGACACGCCCCACCCGTACTTCCGGCGCGCGACCTGGAAGCGGAAGAGATTTCGTTTTTCTCTTACGCACTCTCGTGCGTCTCACCTGCGTAGTTTTTGCCCGGCGGGAACGCGCAGCGGGGGAAGTTTGTCTCGGTGAAGGGAAGCTTAACGCTGAGACCCCGGAGCGGCGGCAGCCATGGCGGATGTGACCGCCCGTAGCCTGCAGTACGAGTACAAGGCGAACTCGAATCTTGTCCTCCAAGCTGACCGCTCTCTCATTGACCGTACCCGCCGGGATGAGCCCACGGGAGAGGTGCTGTCCCTGGTTGGGAAGCTGGAGGGCACCCGGATGGGAGATAAGGCTCAACGGACCAAACCGCAGATGCAGGAGGAAAGAAGAGCCAAGCGAAGGAAGCGTGACGAGGACCGGCACGACATCAACAAGATGAAGGGGTACACGCTGCTCTCAGAGGGTATCGACGAGATGGTGGGCATCATTTACAAGCCCAAAACCAAAGAGACCCGGGAGACCTACGAGGTGCTGCTTAGCTTCATCCAGGCTGCCCTTGGGGACCAGCCACGTGATATTCTGTGTGGGGCAGCTGATGAAGTTCTAGCTGTCCTAAAGAATGAAAAGCTTCGTGATAAAGAAAGGAGAAAGGAGATCGACTTGCTGTTGGGTCAGACAGATGATACCAGATACCATGTTCTAGTGAACTTGGGCAAAAAGATCACAGACTACGGTGGAGACAAGGAAATCCAGAACATGGATGACAACATTGATGAAACATATGGCGTGAATGTACAGTTTGAGTCTGATGAGGAGGAAGGTGACGAAGATGTGTATGGGGAGGTTCGAGAAGAGGCCTCCGATGACGACATGGAAGGGGACGAGGCAGTGGTGCGCTGCACCCTTTCGGCTAATCTTGTTGCATCTGGGGAACTGATGAGTTCCAAGAAGAAGGATTTGCACCCTCGGGACATTGATGCCTTCTGGCTGCAGCGGCAGCTCAGTCGCTTCTATGATGATGCCATCGTGTCGCAGAAGAAGGCAGACGAAGTGTTGGAGATCTTGAAGACAGCGAGCGATGATCGGGAGTGTGAGAACCAGTTGGTGCTGCTGCTCGGCTTCAACACTTTCGATTTTATTAAAGTGCTGCGGCAGCACAGGATGATGATTTTGTACTGTACCTTGCTGGCCAGTGCTCAGAGTGAAGCTGAAAAGGAAAGGATCATGGGAAAGATGGAGGCCGACCCAGAGCTCTCGAAGTTCCTCTACCAGCTCCACGAGACGGAGAAGGAGGATCTGATCCGGGAGGAGCGGTCCCGGAGGGAGCGAGTGCGGCAGTCCCGAATGGACACTGACCTGGAAACCATGGACCTGGACCAGGGTGGGGAGGCACTGGCCCCGCGGCAGGTTCTCGACTTGGAAGACTTGGTCTTTACCCAGGGGAGCCACTTCATGGCTAATAAACGCTGTCAGCTTCCAGATGGATCCTTCCGTCGCCAGCGCAAGGGCTACGAAGAGGTGCATGTACCTGCTCTGAAGCCCAAGCCTTTTGGCTCAGAGGAGCAACTGCTTCCAGTGGAGAAGCTGCCCAAGTATGCCCAGGCTGGCTTTGAGGGCTTCAAAACACTGAACCGGATCCAGAGTAAGCTGTACCGGGCCGCCCTGGAGACAGATGAGAACCTGCTGCTGTGTGCCCCCACTGGCGCCGGCAAGACCAACGTGGCTCTGATGTGCATGCTCCGAGAGATAGGGAAGCACATCAACATGGATGGCACCATCAATGTGGATGACTTCAAGATCATCTACATCGCTCCCATGCGGTCTTTGGTGCAGGAGATGGTGGGCAGCTTTGGAAAGCGCCTGGCTACCTACGGCATCACTGTCGCCGAGCTGACGGGTGACCACCAGCTGTGCAAGGAGGAGATCAGTGCCACTCAGATCATTGTCTGCACCCCCGAGAAGTGGGACATCATCACCCGCAAAGGCGGCGAGCGCACATACACCCAGCTTGTGCGGCTCATCATCCTGGATGAGATCCATCTCCTTCATGATGACAGAGGTCCTGTCTTAGAGGCGTTGGTGGCCAGGGCCATCCGAAACATTGAAATGACCCAAGAGGATGTCAGGCTCATCGGGCTTAGCGCCACCCTCCCCAACTATGAGGACGTGGCTACCTTTCTACGCGTTGACCCTGCCAAGGGCCTTTTCTACTTTGACAACAGCTTCCGCCCAGTGCCTCTGGAACAGACCTACGTGGGTATCACAGAGAAAAAAGCCATCAAGCGTTTCCAGATCATGAATGAGATAGTCTATGAGAAGATCATGGAACATGCTGGAAAAAATCAGGTACTGGTGTTTGTCCATTCCCGGAAGGAGACGGGGAAGACGGCCAGGGCTATCCGGGACATGTGCCTTGAGAAGGACACACTGGGCCTATTTCTCCGAGAGGGCTCTGCCTCCACCGAGGTCCTGCGGACGGAAGCCGAGCAGTGCAAGAACCTGGAGCTGAAGGACCTTCTGCCCTATGGCTTTGCCATTCACCATGCGGGCATGACCAGGGTGGACAGGACACTTGTGGAGGATCTCTTTGCTGACAGGCACATTCAGGTTTTAGTCTCCACAGCAACTCTGGCTTGGGGTGTGAACCTCCCTGCACACACAGTTATCATCAAAGGCACCCAGGTGTACAGTCCGGAGAAGGGGCGCTGGACGGAACTGGGGGCTCTGGATATTCTGCAGATGCTGGGACGTGCTGGAAGACCCCAGTACGACACCAAGGGTGAAGGCATACTCATCACGTCTCACGGGGAGCTCCAGTACTACCTGTCCCTCCTCAACCAGCAGCTTCCTATTGAGAGCCAGATGGTGTCAAAGCTGCCCGACATGCTCAACGCGGAGGTGGTACTGGGCAATGTCCAAAACGCGAAGGATGCGGTGAACTGGTTGGGCTATGCCTACTTGTACATACGCATGCTGCGGTCCCCAACCCTCTACGGCATCTCTCACGACGATCTCAAGGGAGACCCCTTGCTGGACCAGCGCCGACTGGACCTGGTTCACACTGCCGCCTTGATGCTAGATAAGAACAACCTGGTCAAGTATGACAAGAAGACGGGAAACTTCCAGGTGACAGAACTGGGTCGTATAGCCAGCCACTACTACATCACCAATGACACGGTGCAGACCTACAATCAGCTGCTGAAGCCCACCCTGAGTGAGATCGAGCTTTTCAGGGTCTTCTCGCTGTCCTCGGAGTTTAAGAACATCACCGTGAGAGAGGAGGAGAAACTGGAGCTGCAGAAGCTGTTGGAGCGGGTGCCCATCCCTGTGAAGGAGAGCATTGAGGAACCCAGTGCGAAGATCAATGTGCTTCTCCAAGCCTTCATCTCACAGCTGAAATTGGAGGGCTTTGCACTGATGGCTGACATGGTATATGTGACACAGTCAGCGGGCCGGTTGATGCGGGCCATCTTTGAAATTGTTCTGAACCGAGGTTGGGCGCAGCTGACAGACAAGACCCTGAACCTCTGCAAGATGATTGACAAACGCATGTGGCAGTCCATGTGTCCTCTGCGTCAGTTCCGGAAACTCCCTGAGGAGGTAGTGAAGAAGATTGAGAAAAAGAACTTCCCTTTTGAGCGTCTGTACGACCTGAACCACAATGAGATAGGGGAGCTCATCCGCATGCCCAAGATGGGCAAGACAATCCACAAGTACGTCCACCTGTTCCCCAAGTTGGAGCTGTCTGTGCATCTGCAGCCCATCACGCGCTCCACCTTAAAGGTGGAGCTGACCATCACGCCGGACTTCCAGTGGGATGAAAAGGTCCATGGTTCATCAGAGGCCTTTTGGATTCTGGTGGAGGATGTGGACAGCGAAGTGATACTGCACCATGAGTACTTTCTGCTCAAGGCCAAGTACGCCCAGGACGAGCACCTTATCACGTTCTTCGTGCCTGTTTTTGAACCGCTGCCCCCTCAATACTTCATCCGTGTGGTGTCTGACCGCTGGCTCTCTTGCGAGACCCAGCTGCCTGTCTCCTTCCGACACCTGATCCTGCCGGAGAAGTACCCGCCTCCCACCGAGCTGCTGGACCTGCAGCCCTTGCCCGTGTCCGCCCTGAGAAACAGTGCCTTCGAGAGCCTTTACCAAGACAAATTCCCCTTTTTCAATCCCATCCAGACACAAGTGTTCAACACCGTGTACAACAGCGACGACAATGTGTTTGTGGGGGCCCCCACCGGCAGTGGGAAGACCATCTGTGCGGAGTTCGCCATCCTGCGGATGTTGCTGCAGAACTCGGAGGGGCGCTGCGTCTATATCACCCCCATGGAGGCACTGGCCGAGCAGGTGTACATGGACTGGCACGAGAAGTTCCAGGACAGGCTCAGCAAGAAGGTGGTGCTCCTGACGGGCGAGACCAGCACGGACCTGAAGCTGCTGGGCAAGGGCAGCATTGTCATCGGTACCCCCGAGAGGTGGGACATCCTCTCTCGGCGCTGGAAGCAGCGCAAGAACGTCCAGAACATCAGCCTGTTCGTGGTGGACGAGGCCCACCTCATCGGGGGCGAGAACGGGCCTGTCTTGGAAGTGATCTGCTCCCGGATGCGCTACATCTCCTCCCAGATTGAGCGGCCCATTCGTGTTGTGGCGCTTAGCTCCTCGCTCTCAAATGCTAAGGACGTGGCCCACTGGCTAGGCTGCAGTGCCACCTCCACGTTCAACTTCCACCCGAACGTGCGCCCCGTGCCTTTGGAGCTGCACATCCAGGGCTTCAACATCAGTCACACGCAGACTCGCCTATTGTCCATGGCCAAGCCAGTGTACCATGCCATCACCAAGCACTCTCCCAAGAAGCCTGTCATCGTTTTTGTGCCTTCTCGTAAGCAGACCCGCCTTACGGCAATTGACATCCTCACCACGTGTGCGGCGGACATCCAACGACAGAGGTTCTTACACTGCACCGAGAAGGATCTGATCCCGTACCTGGAAAAGCTGAGTGACAGCACGCTCAAGGAGACGCTGTTAAACGGCGTGGGCTACTTGCATGAGGGTCTCAGCCCCCTGGAGCGGCGTCTGGTGGGACAGCTCTTCAGCTCAGGGGCCATCCAGGTAGTTGTTGCTTCTCGGAGTCTCTGCTGGGGCCTGAGTGTGACCGCCCACCTGGTGATCATCATGGACACCCAGTACTACAATGGCAAGATCCACGCGTATGTGGACTACCCCATCTATGATGTGCTTCAGATGGTGGGGCACGCCAACCGCCCTCTGCAGGATGACGAGGGGCGTTGTGTCATCATGTGCCAGGGCTCCAAAAAGGATTTCTTTAAGAAGTTCTTATATGAGCCATTGCCAGTGGAGTCTCACCTGGACCACTGTATGCATGACCACTTCAATGCCGAGATTGTCACCAAGACCATTGAGAACAAGCAGGACGCTGTAGACTACCTTACCTGGACCTTTCTGTACCGCCGCATGACGCAGAACCCCAACTACTACAACTTGCAGGGCATCTCCCATCGTCACCTGTCTGACCACTTGTCAGAGCTGGTGGAGCAGACGCTGAGTGACCTGGAGCAGTCCAAGTGCATCAGCATAGAGGACGAGATGGACGTGGCTCCTCTAAACCTGGGCATGATCGCCGCCTACTACTACATCAACTACACCACTATCGAGCTCTTCAGCATGTCCCTGAATGCCAAGACCAAGGTGCGTGGGCTAATCGAGATCATCTCCAACGCAGCCGAGTACGAAAACATCCCGATCCGGCACCACGAGGACAACCTGCTGCGGCAGTTGGCTCAGAAGGTCCCCCACAAGCTGAACAACCCCAAGTTCAATGACCCACATGTCAAGACCAATCTACTTCTTCAGGCTCATCTGTCTCGTATGCAGCTGAGCGCTGAGCTGCAGTCAGATACAGAGGAGATCCTTAGCAAGGCCATCCGGCTCATCCAGGCCTGTGTGGATGTCCTCTCCAGCAATGGGTGGCTCAGCCCTGCTCTGGCAGCCATGGAGCTGGCCCAGATGGTCACCCAAGCCATGTGGTCTAAGGACTCATACCTGAAACAGCTGCCTCATTTCACTTCGGAGCACATCAAACGTTGCACAGACAAGGGAGTGGAGAGTGTTTTCGACATCATGGAGATGGAGGATGAAGAACGGAACGCATTGCTTCAGCTGTCTGACAGCCAGATGGCAGACGTGGCCCGTTTCTGTAACCGCTACCCTAACATTGAGCTGTCTTACGAAGTTGTGGATAAGGACGGCATCCGCAGTGGCGGGCCCGTTGTGGTGCTGGTGCAGTTGGAGCGAGAGGAGGAAGTCACAGGCCCCGTGATTGCGCCTCTCTTCCCACAGAAACGTGAGGAGGGCTGGTGGGTGGTGATTGGAGACGCCAAGTCCAACAGCCTTATCTCCATCAAGAGGCTGACCCTGCAGCAGAAGGCCAAGGTGAAGCTTGACTTTGTGGCCCCAGCCACTGGCGCCCACAACTACACTCTATATTTCATGAGCGATGCTTACATGGGATGTGACCAAGAATACAAGTTCAGTGTAGATGTGAAAGAAGCCGAGACAGACAGCGACTCGGATTGAGTGTGGAGGCCTGTGCTCTTGCCTGGAGGGGTTGGACCTGAACAAAGAGCATGTCTGGGTCACAGTTGTGGACAGTAAGTCTGCTGGCATGAGGGCGGACTGCCAGGCAGTGCAGGTGCACCCCAGGGCCCCTCCACATTTCCTCTTGCCACCTTGGCATCCAAGCTTTGGATCCGGTGTCTGTAGGTGTCGTGTAGCTGTCGTGTTAACTGGATAGCATTTTTAGGCATGTTCTTTGTTTTATTAGGTGTTTTAATAAAATCAGTTGGAGAAATCA