Transcript asmbl_62980

Sequence
Transcript Sequence for observation asmbl_62980 of TGE0003927:
ATAGAATAAAGGCAGTTTTCTAAACTTCCTGTATCCTGGTGTTTGTGTTACTCTCTCCAGTGCTGGGAGTGGGAGGATGGACTCGGCCTAACTCGCCTTAGAAGGTTCCTTTAGGTACTTCAAAGTACCAGCTTGCCCACCACCACCCCCTTCCCCAATCTGGCACTAACCTGGCTCCTCCCAACAACATGGAAATGATTATCTCATCACATTCAGGTTCAGAGTGGGGTGGAGTGAGGAATGCAGCCTGCTGCGGAGACATGAGGGCACTCTGAGCAGTCGTTCTTCTGCACGGATCAGGAATGTGACGTTTTTCTCTTACTCCCTGTCCATTTTCAGTGCCTCTTCCAGGGTTGAGCTTCAGATGAAGTTGACTATGTATGGAGAGTGGCCTGAAGTCAGCAGGGTCCACTGGGCCCTGCATCCTGTTGGGCTCCCCTCCAGGAGGCTGGGGTTGGGCCTCAGCGGCTCCTTGAGAGAAGCTGTGCCCCAGCAGTGCACACTGGGGGCCTAAGAGGAGGGAGACCAGAGGCCTGGACCTATACGTGTTCCAGGCAGCCCCGGAATGCAGGGAAATGAGAGCTGGCTTTTGGAGCCTGAGCCTTCCCTGGCTACTTCTGGCATTGCCCACCCTCTTCCACCTTAGCTTTCCTAGACCCATGGAGCCTCATCACAGAGAAATTGTCTTGGCAGCTGCTGCCAACTGCAGCATCACCGCAAGTCAGAACTCGCCCTGCACCTGGCGACAAAACGTTACATTCTGCAAGTATAGTAGTATAGCATAGGCTGGGGAGCGCTTTGAGACCTTGGCTCGGGTGCCAGGCGGGGTAACGGGTGGTTGCAGCAGTGTGGGCCTTGCCTGGGCCGGACCAGACGTGCCCGCGGCTCCGCCTCGTCTGGGCGGTGTCCGCATCCGGCCAGGCCGCACCCCGCCCGCCTTGCTAGTCAACCTCCCCAGGGAGACCTGATTCCGGATGAGGCGGGACCGAAGGGGCGGGGCGGAGCGGTCGGGAAAAGCGCCTCCGCCACGTGACCCTATTGGCCCCTATTAGAAAGCGCACCCCGGGCCCCCTGGTGTCTGTCTCACCAGTGCTTCCCCTCTTCCACGACATGTGCGCCGCTCAGCTGACGGCGGCCGCGGCGGCCGCGCAGGCGGCTGCGGCCCCGGGCTCCGTGTATGCCTACTCCGCGCGCCCGCTGGCGGGCGGGGAGCCCGTGAGCCTGGGCTCCCTGCGGGGCAAGGTGCTGCTCATTGAGAATGTGGCGTCGCTCTGAGGCACAACGGTCCGGGACTACACCCAGATGAACGAGCTGCAGCGGCGCCTCGGGCCCCGGGGTCTGGTGGTGCTCGGCTTCCCGTGCAACCAGTTCGGGCATCAGGAAAACACCAAAAACGAAGAGATCCTGAATTCTCTCAAGTACGTCCGACCTGGCGGCGGGTTCGAGCCCAACTTCACGCTCTTCGAGAAGTGCGACGTGAACGGCGCACAGGCGCACCCGCTCTTCACCTTCTTGAGGGAGGCTCTGCCGGCGCCCAGTGACGACACCACCGCGCTAATGACCGATCCCAAGTTCATCATCTGGTCTCCGGTATGCCGCAACGACATTGCCTGGAACTTCGAGAAGTTCCTGGTGGGCCGGGACGGCGTTCCTGTGCGCAGATACAGCCGCCGCTTCCCGACCATCGACATCGAGCCCGACATCGAAGCCCTGCTGTCCCAGGGGCCTAGCAGTGCCTAGGGCACCCCTGCTGCCTCTGCTTCTTGGCAGACACAGCGCTGCCCTCCGGGGGTTTTATCCATGATGGTGTTTCCGCTAAACCTGCAAGGAGGTACACCTGATGTCCAGGAAAATCCCCTGGGGTGGGCGCTGGGCCTGACCATCACAGCCTCTCCCTCCCACACCGCCACCCCTCTCAATAAAGT