Transcript asmbl_61533

Sequence
Transcript Sequence for observation asmbl_61533 of TGE0001765:
CTGGGCCCTGCGGCTCTGATTGGACGGCCAAGACCCATTCGCTGATTGGCCGCGTGGGCGAGGCAGAGGAGAGCCGTGCGCAGCAGCGCATTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCCAGGACCCTGAAAATAAACAGCCGCTACTTTGCGAGCGTCTCTCCCTGGGTCTGCGTCATTTTCTCTGCCGCTTCGGGCCCGTTCAGACACCGAAGATCTGACTGTAGCCATGAGCAGCAATGAGTGCTTCAAGTGTGGACGATCTGGCCACTGGGCCCGGGAATGCCCGACTGGTGGAGGCCGTGGTCGTGGAATGAGAAGCCGTGGCAGAGGTGGTTTTACCTCAGATAGAGGTTTCCAGTTTGTTTCTTCATCTCTTCCAGACATCTGTTATCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTTCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGTTACAACTGTGGCAAACCAGGCCATCTGGCTCGTGACTGTGATCATGCGGATGAGCAGAAGTGCTATTCTTGTGGAGAATTTGGACACATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAACTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCACCTTGCCCGGGAATGCACGATTGAGGCCACAGCTTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGACAGAGGCTACTCCCAGGCCAGTGAGCTTTACTTGCTGTGTAAAAGAAGGAAAGGGGTGGAAAAAAAATCGACTTTCTGCATTTAACTACAAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGCGCCACTGGTGAATAGGGATTGATGAATGGGAAGAGCTGAGTCAGACCAGTAAGCCCATTGTGGGTTTTTTGAATATGTTCCCATGTAGGAGGTAAAAACCAGTTCTGGAAGTGTCTGTGAGCTTCCATAAATAACTTTTAATTTTAGCATAATAATGGCCTTGGATTATCTGACCTCAGTAGCTGTTAAATAACATCTGTATCAGGCCATACATAGAACGTACAGTTGAGTGGGAGTAAACAAAATAAAAAGACAAACGTGTGTTAATATCTATGCGAGAAAAATCGGGATAAAAGCCTAAACAGGAACAACTTCCTAGCATTGATGCTGGATAAGCAGATGGTGATGGCAAAAGTTTAGAACACATTTTTTTCAAAGACTAAATCTAAAATGCAGAGTAAACATCTATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAGTGCATTTTCACAAAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTTTCATTTGCTGTAATCAGTTTTTTAAAGTCAGATGGAAAAAGCAACTGAAGTCCTAGAAAATAGAAATGTAATTTTAAACTATCCAATAAAGCTGGAGGAGGAAGGGGAGTTTGACTAAAGTTCTTTTTGTTTGTTTTAAATTTTCATTGATGTATATAGTGCAAAATGCCATATTAAAGAGGGGAATGTGGAGTACTGAAAGCTGATAGTTTGGACTTTTCTTTTTGTTACCTCAGTCGTGTCTTCGATAATGAAATATAGCTATTACAAGGAAGCATAGGCTTTATAGTTTGGTGTCAATTGTGTTGCAGGGATGTAGAAAACATAATCCTCTTTCTAATCTTTTATAATGCCTTTTAGTTCATGTTCATTCTGAATAGTTTAAAACCATTGCTGTGTTTTAGCATTTCATATTTTTCCTAAGCTTCACAAAGGTCTGAAATGTTGGATTCCTTGTTTTTCTAGGATCTGGAGTTGAGATGGACCTTAGAAATCATCTCGTTTAATGAACTCACTTTATAGATGAGTTACTAGAAGTTTAATTTGCTTGAAGGAACAAATTAGAACCTAGAGCCTCAAGTGTCTTTCCCACCCTATGTTCTCTGTTCTTTTTTATTCTCCCACTGAACTAAATACAGTTAGTGGTATATTTTTTCCCAACCTTCCCCCCCACACACCCTTTTTACAGTGCCATGTCATTCTTGACCTTAGATGTATTGTGAATTTTTCATCTCTTTCTAGGGTCTGATCAGTTTGTGATGCTGTGGTGTTAAGATGTTAGTGTCTAATCTGTGCTGTGCCAGTTCTAACTTTGTCCAAATTAGTGGTCCAAAGCAAGCAAGAAAGTGAAATCATGGCAGGTTTATTTCTTTATGAATATAGATTTACATGTTTCTTCTTCATTTTATATTTTTACTGAGAAAAGTCAGATGTTAACTAAGCATGTTAAATATAATGTTGATAATTTTAGTTTCTACTGCAGTATGAAACAGCCTAACAGAAGACCTTATTTTCAAAGGCATCACTGTTAAATGTAATTAAATTTAAGGTTAGTGGTGGTGGTGCATGCACAGAGGGTTATTTTCCCCCAGGGTTTCTGGTGTCAAGTAGAAAAACATAAAACATAGAAAATGAGATATTTAGAACTGTTTTTTTGCTTCGTACTATTCTCGGGACTGCATTTGGAATATCTGGGGGCATTTTGTTTCAGGACCCTTTGATACGCAAGAACCTACTCACAGCTGACCATAAAGTGTTCTTTAATGAGATACCATTTGTTTGCATTGACTTTGGTGACTGAGCAAGTGCAATGTGAAAATAAGTTTTGCATGGAAGTTAAGCTAATTACTAGGAACCAGTGGGTAAGAACCTGGATTCTTGGAAGCGAATTCTTCCTACAGGAGATATGGACTAGGAAGAAACCAATCCCCTGTGTTTCTGTAATATCTGCTGACTTTCACATCCCTGTGTAAACTAGATAAAAGGTCAAGGATTTCACTTATTACATGGGTTGAGGGGATGAAGGAAAGATAAATGGAGGTAATACAATGAATTTTGCATTGTCTAAAGGATAAAACTTTATCTTGCTCTTGCATCCCTGTTAGGTTTTGCTGCTTTTTTGCCTTCTTTTATAATAGCTATTTCTCCTTAATTTCTTGAAGCTTCTTTATCAGTGACTTGAGTAGATCAAAAGGTCTTGCATAGCCAGTTTTTTTAAACCAGGTCCAGTCAAGGTGTATAAATTGCATTTGGTTAAGTTTCTTTAGTCTCAATCTTCCAAGTTTCTCACTTTTCCTCCTTATAACCTTGATTTTTTTTCAAGAATGTCCTATATTTACTGATTTTTTTTCTTCATGGTGTCATTTAGCTTGTTTATATCTTCTCTATTTCCTGATCTAGAGGCTTGATCATTGGGTTTAGCTCCAGTTCTGGCAAGCATGTAATGTTTCATTACATCAGTTTTACCATTAATATAGAACTTGATCATTTAAGGCGATCTTTTCTTTCATTGTAGTGATAATACATTTGAAAATTTAGTAGTCTATCTCAGTATCCTTTCACTTAATGCTTTTAGCATTTATCATCTGTTGCTTTATGTTCATAAACATGTATAAAAGGAATATAGAATGTAATTACACTGGTTCAGTAAAACCACATTATACTGAGAGTGATATAGTGCACTTCCATGGTTTTGAATTTCTTTATAAATCTTGAATGTCATTAAAAAAACATAAGGAAAAGTTGGTTTTCTTAAATAGTCACATTTCTGTTGTAGTTGTGAGGAAAAATTTCAAAATGAGCATTCACATATAGTTCTTGATAGATTTTGCCTGGGAAGA