Transcript asmbl_61532

Sequence
Transcript Sequence for observation asmbl_61532 of TGE0001766:
CTGGGCCCTGCGGCTCTGATTGGACGGCCAAGACCCATTCGCTGATTGGCCGCGTGGGCGAGGCAGAGGAGAGCCGTGCGCAGCAGCGCATTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCCAGGACCCTGAAAATAAACAGCCGCTACTTTGCGAGCGTCTCTCCCTGGGTCTGCGTCATTTTCTCTGCCGCTTCGGGCCCGTTCAGACACCGAAGAATAATTATCAAAAAATACACTAAAAGCTAGAAGTAATTTCAAGTGGTTAAATGTTGTTTTTAATACTTTGAAGATCTGACTGTAGCCATGAGCAGCAATGAGTGCTTCAAGTGTGGACGATCTGGCCACTGGGCCCGGGAATGCCCGACTGGTGGAGGCCGTGGTCGTGGAATGAGAAGCCGTGGCAGAGGTTTCCAGTTTGTTTCTTCATCTCTTCCAGACATCTGTTATCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTTCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGTTACAACTGTGGCAAACCAGGCCATCTGGCTCGTGACTGTGATCATGCGGATGAGCAGAAGTGCTATTCTTGTGGAGAATTTGGACACATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAACTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCACCTTGCCCGGGAATGCACGATTGAGGCCACAGCTTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGACAGAGGCTACTCCCAGGCCAGTGAGCTTTACTTGCTGTGTAAAAGAAGGAAAGGGGTGGAAAAAAAATCGACTTTCTGCATTTAACTACAAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGCGCCACTGGTGAATAGGGATTGATGAATGGGAAGAGCTGAGTCAGACCAGTAAGCCCATTGTGGGTTTTTTGAATATGTTCCCATGTAGGAGGTAAAAACCAGTTCTGGAAGTGTCTGTGAGCTTCCATAAATAACTTTTAATTTTAGCATAATAATGGCCTTGGATTATCTGACCTCAGTAGCTGTTAAATAACATCTGTATCAGGCCATACATAGAACGTACAGTTGAGTGGGAGTAAACAAAATAAAAAGACAAACGTGTGTTAATATCTATGCGAGAAAAATCGGGATAAAAGCCTAAACAGGAACAACTTCCTAGCATTGATGCTGGATAAGCAGATGGTGATGGCAAAAGTTTAGAACACATTTTTTTCAAAGACTAAATCTAAAATGCAGAGTAAACATCTATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAGTGCATTTTCACAAAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTTTCATTTGCTGTAATCAGTTTTTTAAAGTCAGATGGAAAAAGCAACTGAAGTCCTAGAAAATAGAAATGTAATTTTAAACTATCCAATAAAGCTGGAGGAGGAAGGGGAGTTTGACTAAAGTTCTTTTTGTTTGTTTTAAATTTTCATTGATGTATATAGTGCAAAATGCCATATTAAAGAGGGGAATGTGGAGTACTGAAAGCTGATAGTTTGGACTTTTCTTTTTGTTACCTCAGTCGTGTCTTCGATAATGAAATATAGCTATTACAAGGAAGCATAGGCTTTATAGTTTGGTGTCAATTGTGTTGCAGGGATGTAGAAAACATAATCCTCTTTCTAATCTTTTATAATGCCTTTTAGTTCATGTTCATTCTGAATAGTTTAAAACCATTGCTGTGTTTTAGCATTTCATATTTTTCCTAAGCTTCACAAAGGTCTGAAATGTTGGATTCCTTGTTTTTCTAGGATCTGGAGTTGAGATGGACCTTAGAAATCATCTCGTTTAATGAACTCACTTTATAGATGAGTTACTAGAAGTTTAATTTGCTTGAAGGAACAAATTAGAACCTAGAGCCTCAAGTGTCTTTCCCACCCTATGTTCTCTGTTCTTTTTTATTCTCCCACTGAACTAAATACAGTTAGTGGTATATTTTTTCCCAACCTTCCCCCCCACACACCCTTTTTACAGTGCCATGTCATTCTTGACCTTAGATGTATTGTGAATTTTTCATCTCTTTCTAGGGTCTGATCAGTTTGTGATGCTGTGGTGTTAAGATGTTAGTGTCTAATCTGTGCTGTGCCAGTTCTAACTTTGTCCAAATTAGTGGTCCAAAGCAAGCAAGAAAGTGAAATCATGGCAGGTTTATTTCTTTATGAATATAGATTTACATGTTTCTTCTTCATTTTATATTTTTACTGAGAAAAGTCAGATGTTAACTAAGCATGTTAAATATAATGTTGATAATTTTAGTTTCTACTGCAGTATGAAACAGCCTAACAGAAGACCTTATTTTCAAAGGCATCACTGTTAAATGTAATTAAATTTAAGGTTAGTGGTGGTGGTGCATGCACAGAGGGTTATTTTCCCCCAGGGTTTCTGGTGTCAAGTAGAAAAACATAAAACATAGAAAATGAGATATTTAGAACTGTTTTTTTGCTTCGTACTATTCTCGGGACTGCATTTGGAATATCTGGGGGCATTTTGTTTCAGGACCCTTTGATACGCAAGAACCTACTCACAGCTGACCATAAAGTGTTCTTTAATGAGATACCATTTGTTTGCATTGACTTTGGTGACTGAGCAAGTGCAATGTGAAAATAAGTTTTGCATGGAAGTTAAGCTAATTACTAGGAACCAGTGGGTAAGAACCTGGATTCTTGGAAGCGAATTCTTCCTACAGGAGATATGGACTAGGAAGAAACCAATCCCCTGTGTTTCTGTAATATCTGCTGACTTTCACATCCCTGTGTAAACTAGATAAAAGGTCAAGGATTTCACTTATTACATGGGTTGAGGGGATGAAGGAAAGATAAATGGAGGTAATACAATGAATTTTGCATTGTCTAAAGGATAAAACTTTATCTTGCTCTTGCATCCCTGTTAGGTTTTGCTGCTTTTTTGCCTTCTTTTATAATAGCTATTTCTCCTTAATTTCTTGAAGCTTCTTTATCAGTGACTTGAGTAGATCAAAAGGTCTTGCATAGCCAGTTTTTTTAAACCAGGTCCAGTCAAGGTGTATAAATTGCATTTGGTTAAGTTTCTTTAGTCTCAATCTTCCAAGTTTCTCACTTTTCCTCCTTATAACCTTGATTTTTTTTCAAGAATGTCCTATATTTACTGATTTTTTTTCTTCATGGTGTCATTTAGCTTGTTTATATCTTCTCTATTTCCTGATCTAGAGGCTTGATCATTGGGTTTAGCTCCAGTTCTGGCAAGCATGTAATGTTTCATTACATCAGTTTTACCATTAATATAGAACTTGATCATTTAAGGCGATCTTTTCTTTCATTGTAGTGATAATACATTTGAAAATTTAGTAGTCTATCTCAGTATCCTTTCACTTAATGCTTTTAGCATTTATCATCTGTTGCTTTATGTTCATAAACATGTATAAAAGGAATATAGAATGTAATTACACTGGTTCAGTAAAACCACATTATACTGAGAGTGATATAGTGCACTTCCATGGTTTTGAATTTCTTTATAAATCTTGAATGTCATTAAAAAAACATAAGGAAAAGTTGGTTTTCTTAAATAGTCACATTTCTGTTGTAGTTGTGAGGAAAAATTTCAAAATGAGCATTCACATATAGTTCTTGATAGATTTTGCCTGGGAAGA