Transcript asmbl_61531

Sequence
Transcript Sequence for observation asmbl_61531 of TGE0001765:
CTGGGCCCTGCGGCTCTGATTGGACGGCCAAGACCCATTCGCTGATTGGCCGCGTGGGCGAGGCAGAGGAGAGCCGTGCGCAGCAGCGCATTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCCAGGACCCTGAAAATAAACAGCCGCTACTTTGCGAGCGTCTCTCCCTGGGTCTGCGTCATTTTCTCTGCCGCTTCGGGCCCGTTCAGACACCGAAGAATAATTATCAAAAAATACACTAAAAGCTAGAAGTAATTTCAAGTGGTTAAATGTTGTTTTTAATACTTTGAAGATCTGACTGTAGCCATGAGCAGCAATGAGTGCTTCAAGTGTGGACGATCTGGCCACTGGGCCCGGGAATGCCCGACTGGTGGAGGCCGTGGTCGTGGAATGAGAAGCCGTGGCAGAGGTGGTTTTACCTCAGATAGAGGTTTCCAGTTTGTTTCTTCATCTCTTCCAGACATCTGTTATCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTTCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGTTACAACTGTGGCAAACCAGGCCATCTGGCTCGTGACTGTGATCATGCGGATGAGCAGAAGTGCTATTCTTGTGGAGAATTTGGACACATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAACTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCACCTTGCCCGGGAATGCACGATTGAGGCCACAGCTTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGACAGAGGCTACTCCCAGGCCAGTGAGCTTTACTTGCTGTGTAAAAGAAGGAAAGGGGTGGAAAAAAAATCGACTTTCTGCATTTAACTACAAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGCGCCACTGGTGAATAGGGATTGATGAATGGGAAGAGCTGAGTCAGACCAGTAAGCCCATTGTGGGTTTTTTGAATATGTTCCCATGTAGGAGGTAAAAACCAGTTCTGGAAGTGTCTGTGAGCTTCCATAAATAACTTTTAATTTTAGCATAATAATGGCCTTGGATTATCTGACCTCAGTAGCTGTTAAATAACATCTGTATCAGGCCATACATAGAACGTACAGTTGAGTGGGAGTAAACAAAATAAAAAGACAAACGTGTGTTAATATCTATGCGAGAAAAATCGGGATAAAAGCCTAAACAGGAACAACTTCCTAGCATTGATGCTGGATAAGCAGATGGTGATGGCAAAAGTTTAGAACACATTTTTTTCAAAGACTAAATCTAAAATGCAGAGTAAACATCTATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAGTGCATTTTCACAAAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTTTCATTTGCTGTAATCAGTTTTTTAAAGTCAGATGGAAAAAGCAACTGAAGTCCTAGAAAATAGAAATGTAATTTTAAACTATCCAATAAAGCTGGAGGAGGAAGGGGAGTTTGACTAAAGTTCTTTTTGTTTGTTTTAAATTTTCATTGATGTATATAGTGCAAAATGCCATATTAAAGAGGGGAATGTGGAGTACTGAAAGCTGATAGTTTGGACTTTTCTTTTTGTTACCTCAGTCGTGTCTTCGATAATGAAATATAGCTATTACAAGGAAGCATAGGCTTTATAGTTTGGTGTCAATTGTGTTGCAGGGATGTAGAAAACATAATCCTCTTTCTAATCTTTTATAATGCCTTTTAGTTCATGTTCATTCTGAATAGTTTAAAACCATTGCTGTGTTTTAGCATTTCATATTTTTCCTAAGCTTCACAAAGGTCTGAAATGTTGGATTCCTTGTTTTTCTAGGATCTGGAGTTGAGATGGACCTTAGAAATCATCTCGTTTAATGAACTCACTTTATAGATGAGTTACTAGAAGTTTAATTTGCTTGAAGGAACAAATTAGAACCTAGAGCCTCAAGTGTCTTTCCCACCCTATGTTCTCTGTTCTTTTTTATTCTCCCACTGAACTAAATACAGTTAGTGGTATATTTTTTCCCAACCTTCCCCCCCACACACCCTTTTTACAGTGCCATGTCATTCTTGACCTTAGATGTATTGTGAATTTTTCATCTCTTTCTAGGGTCTGATCAGTTTGTGATGCTGTGGTGTTAAGATGTTAGTGTCTAATCTGTGCTGTGCCAGTTCTAACTTTGTCCAAATTAGTGGTCCAAAGCAAGCAAGAAAGTGAAATCATGGCAGGTTTATTTCTTTATGAATATAGATTTACATGTTTCTTCTTCATTTTATATTTTTACTGAGAAAAGTCAGATGTTAACTAAGCATGTTAAATATAATGTTGATAATTTTAGTTTCTACTGCAGTATGAAACAGCCTAACAGAAGACCTTATTTTCAAAGGCATCACTGTTAAATGTAATTAAATTTAAGGTTAGTGGTGGTGGTGCATGCACAGAGGGTTATTTTCCCCCAGGGTTTCTGGTGTCAAGTAGAAAAACATAAAACATAGAAAATGAGATATTTAGAACTGTTTTTTTGCTTCGTACTATTCTCGGGACTGCATTTGGAATATCTGGGGGCATTTTGTTTCAGGACCCTTTGATACGCAAGAACCTACTCACAGCTGACCATAAAGTGTTCTTTAATGAGATACCATTTGTTTGCATTGACTTTGGTGACTGAGCAAGTGCAATGTGAAAATAAGTTTTGCATGGAAGTTAAGCTAATTACTAGGAACCAGTGGGTAAGAACCTGGATTCTTGGAAGCGAATTCTTCCTACAGGAGATATGGACTAGGAAGAAACCAATCCCCTGTGTTTCTGTAATATCTGCTGACTTTCACATCCCTGTGTAAACTAGATAAAAGGTCAAGGATTTCACTTATTACATGGGTTGAGGGGATGAAGGAAAGATAAATGGAGGTAATACAATGAATTTTGCATTGTCTAAAGGATAAAACTTTATCTTGCTCTTGCATCCCTGTTAGGTTTTGCTGCTTTTTTGCCTTCTTTTATAATAGCTATTTCTCCTTAATTTCTTGAAGCTTCTTTATCAGTGACTTGAGTAGATCAAAAGGTCTTGCATAGCCAGTTTTTTTAAACCAGGTCCAGTCAAGGTGTATAAATTGCATTTGGTTAAGTTTCTTTAGTCTCAATCTTCCAAGTTTCTCACTTTTCCTCCTTATAACCTTGATTTTTTTTCAAGAATGTCCTATATTTACTGATTTTTTTTCTTCATGGTGTCATTTAGCTTGTTTATATCTTCTCTATTTCCTGATCTAGAGGCTTGATCATTGGGTTTAGCTCCAGTTCTGGCAAGCATGTAATGTTTCATTACATCAGTTTTACCATTAATATAGAACTTGATCATTTAAGGCGATCTTTTCTTTCATTGTAGTGATAATACATTTGAAAATTTAGTAGTCTATCTCAGTATCCTTTCACTTAATGCTTTTAGCATTTATCATCTGTTGCTTTATGTTCATAAACATGTATAAAAGGAATATAGAATGTAATTACACTGGTTCAGTAAAACCACATTATACTGAGAGTGATATAGTGCACTTCCATGGTTTTGAATTTCTTTATAAATCTTGAATGTCATTAAAAAAACATAAGGAAAAGTTGGTTTTCTTAAATAGTCACATTTCTGTTGTAGTTGTGAGGAAAAATTTCAAAATGAGCATTCACATATAGTTCTTGATAGATTTTGCCTGGGAAGA