Transcript asmbl_61530

Sequence
Transcript Sequence for observation asmbl_61530 of TGE0001766:
CTGGGCCCTGCGGCTCTGATTGGACGGCCAAGACCCATTCGCTGATTGGCCGCGTGGGCGAGGCAGAGGAGAGCCGTGCGCAGCAGCGCATTGGGGCCGTGTGCAGACCCGCGTGTGGCGCAGGCCAGGACCCTGAAAATAAACAGCCGCTACTTTGCGAGCGTCTCTCCCTGGGTCTGCGTCATTTTCTCTGCCGCTTCGGGCCCGTTCAGACACCGAAGATCTGACTGTAGCCATGAGCAGCAATGAGTGCTTCAAGTGTGGACGATCTGGCCACTGGGCCCGGGAATGCCCGACTGGTGGAGGCCGTGGTCGTGGAATGAGAAGCCGTGGCAGAGGTTTCCAGTTTGTTTCTTCATCTCTTCCAGACATCTGTTATCGCTGTGGTGAGTCTGGTCATCTTGCCAAGGATTGTGATCTTCAGGAGGATGCCTGCTATAACTGCGGTAGAGGTGGCCACATTGCCAAGGACTGCAAGGAGCCCAAGAGAGAGCGAGAGCAATGCTGTTACAACTGTGGCAAACCAGGCCATCTGGCTCGTGACTGTGATCATGCGGATGAGCAGAAGTGCTATTCTTGTGGAGAATTTGGACACATTCAAAAAGACTGCACCAAGGTGAAGTGCTATAGGTGTGGTGAAACTGGTCATGTAGCCATCAACTGCAGCAAGACAAGTGAAGTCAACTGTTACCGCTGTGGCGAGTCAGGGCACCTTGCCCGGGAATGCACGATTGAGGCCACAGCTTAATTATTTTCCTTTGTCGCCCCTCCTTTTTCTGATTGATGGTTGTATTATTTTCTCTGAATCCTCTTCACTGGCCAAAGGTTGGCAGACAGAGGCTACTCCCAGGCCAGTGAGCTTTACTTGCTGTGTAAAAGAAGGAAAGGGGTGGAAAAAAAATCGACTTTCTGCATTTAACTACAAAAAAAAGTTTATGTTTAGTTTGGTAGAGGTGTTATGTATAATGCTTTGTTAAAGAACCCCCTTTCCGCGCCACTGGTGAATAGGGATTGATGAATGGGAAGAGCTGAGTCAGACCAGTAAGCCCATTGTGGGTTTTTTGAATATGTTCCCATGTAGGAGGTAAAAACCAGTTCTGGAAGTGTCTGTGAGCTTCCATAAATAACTTTTAATTTTAGCATAATAATGGCCTTGGATTATCTGACCTCAGTAGCTGTTAAATAACATCTGTATCAGGCCATACATAGAACGTACAGTTGAGTGGGAGTAAACAAAATAAAAAGACAAACGTGTGTTAATATCTATGCGAGAAAAATCGGGATAAAAGCCTAAACAGGAACAACTTCCTAGCATTGATGCTGGATAAGCAGATGGTGATGGCAAAAGTTTAGAACACATTTTTTTCAAAGACTAAATCTAAAATGCAGAGTAAACATCTATGCTCAGAGTTAGCATAATTTGGAGCTATTCAGGAATTGCAGAGAAGTGCATTTTCACAAAAATCAAGATGTTATTTTTGTATACTATATCACTTAGACAACTGTTTCATTTGCTGTAATCAGTTTTTTAAAGTCAGATGGAAAAAGCAACTGAAGTCCTAGAAAATAGAAATGTAATTTTAAACTATCCAATAAAGCTGGAGGAGGAAGGGGAGTTTGACTAAAGTTCTTTTTGTTTGTTTTAAATTTTCATTGATGTATATAGTGCAAAATGCCATATTAAAGAGGGGAATGTGGAGTACTGAAAGCTGATAGTTTGGACTTTTCTTTTTGTTACCTCAGTCGTGTCTTCGATAATGAAATATAGCTATTACAAGGAAGCATAGGCTTTATAGTTTGGTGTCAATTGTGTTGCAGGGATGTAGAAAACATAATCCTCTTTCTAATCTTTTATAATGCCTTTTAGTTCATGTTCATTCTGAATAGTTTAAAACCATTGCTGTGTTTTAGCATTTCATATTTTTCCTAAGCTTCACAAAGGTCTGAAATGTTGGATTCCTTGTTTTTCTAGGATCTGGAGTTGAGATGGACCTTAGAAATCATCTCGTTTAATGAACTCACTTTATAGATGAGTTACTAGAAGTTTAATTTGCTTGAAGGAACAAATTAGAACCTAGAGCCTCAAGTGTCTTTCCCACCCTATGTTCTCTGTTCTTTTTTATTCTCCCACTGAACTAAATACAGTTAGTGGTATATTTTTTCCCAACCTTCCCCCCCACACACCCTTTTTACAGTGCCATGTCATTCTTGACCTTAGATGTATTGTGAATTTTTCATCTCTTTCTAGGGTCTGATCAGTTTGTGATGCTGTGGTGTTAAGATGTTAGTGTCTAATCTGTGCTGTGCCAGTTCTAACTTTGTCCAAATTAGTGGTCCAAAGCAAGCAAGAAAGTGAAATCATGGCAGGTTTATTTCTTTATGAATATAGATTTACATGTTTCTTCTTCATTTTATATTTTTACTGAGAAAAGTCAGATGTTAACTAAGCATGTTAAATATAATGTTGATAATTTTAGTTTCTACTGCAGTATGAAACAGCCTAACAGAAGACCTTATTTTCAAAGGCATCACTGTTAAATGTAATTAAATTTAAGGTTAGTGGTGGTGGTGCATGCACAGAGGGTTATTTTCCCCCAGGGTTTCTGGTGTCAAGTAGAAAAACATAAAACATAGAAAATGAGATATTTAGAACTGTTTTTTTGCTTCGTACTATTCTCGGGACTGCATTTGGAATATCTGGGGGCATTTTGTTTCAGGACCCTTTGATACGCAAGAACCTACTCACAGCTGACCATAAAGTGTTCTTTAATGAGATACCATTTGTTTGCATTGACTTTGGTGACTGAGCAAGTGCAATGTGAAAATAAGTTTTGCATGGAAGTTAAGCTAATTACTAGGAACCAGTGGGTAAGAACCTGGATTCTTGGAAGCGAATTCTTCCTACAGGAGATATGGACTAGGAAGAAACCAATCCCCTGTGTTTCTGTAATATCTGCTGACTTTCACATCCCTGTGTAAACTAGATAAAAGGTCAAGGATTTCACTTATTACATGGGTTGAGGGGATGAAGGAAAGATAAATGGAGGTAATACAATGAATTTTGCATTGTCTAAAGGATAAAACTTTATCTTGCTCTTGCATCCCTGTTAGGTTTTGCTGCTTTTTTGCCTTCTTTTATAATAGCTATTTCTCCTTAATTTCTTGAAGCTTCTTTATCAGTGACTTGAGTAGATCAAAAGGTCTTGCATAGCCAGTTTTTTTAAACCAGGTCCAGTCAAGGTGTATAAATTGCATTTGGTTAAGTTTCTTTAGTCTCAATCTTCCAAGTTTCTCACTTTTCCTCCTTATAACCTTGATTTTTTTTCAAGAATGTCCTATATTTACTGATTTTTTTTCTTCATGGTGTCATTTAGCTTGTTTATATCTTCTCTATTTCCTGATCTAGAGGCTTGATCATTGGGTTTAGCTCCAGTTCTGGCAAGCATGTAATGTTTCATTACATCAGTTTTACCATTAATATAGAACTTGATCATTTAAGGCGATCTTTTCTTTCATTGTAGTGATAATACATTTGAAAATTTAGTAGTCTATCTCAGTATCCTTTCACTTAATGCTTTTAGCATTTATCATCTGTTGCTTTATGTTCATAAACATGTATAAAAGGAATATAGAATGTAATTACACTGGTTCAGTAAAACCACATTATACTGAGAGTGATATAGTGCACTTCCATGGTTTTGAATTTCTTTATAAATCTTGAATGTCATTAAAAAAACATAAGGAAAAGTTGGTTTTCTTAAATAGTCACATTTCTGTTGTAGTTGTGAGGAAAAATTTCAAAATGAGCATTCACATATAGTTCTTGATAGATTTTGCCTGGGAAGA