Transcript asmbl_61527

Sequence
Transcript Sequence for observation asmbl_61527 of TGE0001880:
GCCAGAACGTGACGCAGGATTGAGGCGGGGCTCCTCCTTGGCGTGCAGCGTCTCGTGACAGGTACTTCCGCTCGGGGCGGTGGCAGTGACGGAAGTGGGAGCGGAGCCGGATTCTTGGCCATAAAGCCCGAGGCGGCGGTGGTGGCGGCGGCTTTGGAAGCTTGGAGAGCGACGAAGAGTCCGCTGAAACCGGAACTTGGACTTCTCTGCCCCTGTCCTCGCCTTGTAGTTCCTCTTCAGCGGGAGCCTTCGTGACGTGCCCGGCCCGAAGCCCCGTTCGGAGCGGCCGAGTTTGAAGGATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTTATCATCCTGGGAGATTCTGGAGTCGGTAAGACATCACTCATGAACCAGTATGTGAACAAGAAATTCAGTAATCAATACAAAGCCACAATAGGAGCAGACTTTCTGACAAAGGAGGTGATGGTGGATGACAGACTAGTTACAATGCAGATCTGGGACACGGCAGGACAGGAACGGTTCCAGTCTCTTGGTGTGGCCTTTTATAGAGGCGCAGACTGCTGTGTTCTGGTATTTGATGTGACTGCCCCGAACACATTCAAAACCCTTGATAGTTGGAGAGATGAGTTTCTCATCCAGGCCAGCCCTCGGGATCCTGAAAACTTTCCCTTTGTAGTGTTGGGAAATAAGATTGACCTCGAAAACAGACAAGTGGCCACGAAGCGAGCACAGGCCTGGTGCTACAGCAAAAACAACATTCCCTACTTTGAGACCAGTGCCAAGGAGGCCATCAACGTGGAGCAGGCCTTCCAGACGATTGCACGGAATGCACTTAAACAGGAAACAGAGGTGGAGCTGTACAATGAATTTCCTGAACCCATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCGGCAGAAAGCTGCAGTTGCTGAATGGGCAATGAGAGCAGAGCACAGAGTCCTTCACAAACCAAGAACACACTTAGGCCTTCCAACATAAATCCCTTCTCCTCTTCTAAACAAAGCATAAAGTGATTTCTCAGACGCAGTTGCCAAAAGAAACCCCACCAGACACACTCACCCCTCCATACAACACACATACAAATCTGATACAAGCAGACAGACTCCAGTCACAGGCCTGTGAGCTCTATCAGGGTCTGCCCACCTATCACATCAGCCCTCGTATAGCAGCATGACAGGCCAGCTGTAGAAATCGTTCTGGTGTTGGCATCGGAAGCTAATTCTTTTTGTCCACCAGAGAGGGAGAACTGTTTACAGTTAATCTATGTCGGATTGGTTATCTTAATTTTTTTTAATGGTCTTGTGGTCTTTTTACCCCATCCCCATTCCCCTCTTGTGAAGGCTACCACTTGGGAAGGCTGGTGCCCTATGCTTCATTACAGGCTCACACCCAGTCTGTTCAGGCTGAGTTTTGTATGTATCTGTTAATGCTTGTTACTTTTAACTAATCAGATCTTTTTACAGTATCCATTTATTATGTAATGCTTCTTAGAAAAGAATCTTATAGTACATGTTAATATATGCAACCAATTAAAAATGTATAAATTAGTGTAAGAAATTCTTGGATTATGTGTTTAAGTCCTGTAATGCAGGCATGTAAGATGGAGGGTTGAACACTGTCTGGATTGCAGAATGTTAGCAACTCAATTCAGAAATCCAGCTAGAGGCAGTATTCTGTACAGTAAACACAAGAATTATGTACACCTTTTATCAAAGACTTAAGAGCCAAAAAGCTTTTCATCTCTCCAGGGGGAAAACTGTCTAGTTCCCTTCTGTATCTAAATTTTCCAAAAGGTTGATTTGCATAATACAGTGGTGAATGCAGTAGATAAATGGCTGTTGTTAAAATTCTTGTTTTTCCTTTTTTTCTTGCTCCACCCTTTGAAACTCCCCTATTAGATCAGCATCCTACTTATAAGAGGAAAAGGAAAATCCTAACAAATCTGTCCTAGTGATTTACCTTTGTTCTAGAAGGCGCTCTTTTCAGGGTTGTGGTATCCCTTAGGTTAGCAAACCTTTTTCTCCTTTTCCCCACCTCCCCAGTATTGCCCATTATTGATTAACCTGTTTCTTTGGTGTGGAATCCTGGCAGTTCTTCCCCCTTCCTAGGGTCTGCCCCTGCATTCTAGCTTGTTTAATGGAGCACTTCCCCCTTTCCCAAAGGTCTACATTCTAGGGTGTGGGCCAAGTTCTTTCTGTAAAGAGATGAACCTGATGCCAATAAAATGTAACAAGAGCAAAGATCATTGCCTTTGCCCTGTCTTTTTTTGTTCTTCCAGACCTTTGGCTCAGTAGACACCATGTTAGCTAATCATAACCAATGCTTTATCAAGCAAAATAGCCCTCCATAACTGCGCATGTTTGGTGCTTTGAGGCAGAAAGGCCTTCCCATGTCCAGTCCTGCAGTACTTGTCCTTACTTTGTTTCTATTTTTTATCTTAGTCACAGTATTGGAGAGGGGCGCACTCTGAATGGAGAACACATTATCTGTCCCCTTAGAGGAGCAGCCACAAACTACTGGTGACCTATGGACCCTGCACAGCCTCTGAGTGTAACTCAGCCTTAGTGTTGTGTTGCTTTTTAATTGGCGTAGTTCTGGATTTCACTGGAGAGGAAGATTTGGCAGCAGGGACCCTCTATTTTAGCATATATAACCCACCAGCTGAAACTTAATAGATGCCACCTAGAACTAATTTTATAAAATAGTGTTTCAGTCAGTAGGTGGATATAGGTTTTGCAGATGTCCCCTGATGGCTTAGCTCTTGGAGTCTACTTTACTACACTTTTTTACCTTTCCACTTCTAAGGATCATCAGTTGCTTTCTTTCCTTGTACTTACTCTTGAGTCATACTTAACACGTTAAAAATAGCATTCTTAGAAGCTTCTGACTACAACTCCACTGTGGCTAGTGGTGCATGGCCTAACTCTCTGGTCCCACTCCCTGAGCTAGACCTAATTGGTGTTGTATTTGGCTTCTAGAGAAGCAGAATCCTTTCCAGCTTGGGACACACTGACTGGGGCCATGGTTTATGAGCCTTGTGTGATGCTTATCCCTACAAACCAGGCTACTGTTTCTCTCTGATTATGTTCCTCTAGTCCTAACCATGATGGTGACATGAAAATGGACCTTTACCTCTGATCTCAACCATCGTCCTAAAACTGATGATCATCTGGACGTTAACTTGCTTTATCTTGAGAGAGAAGCTTGAATATAACCGTATAAGTTGCCCTGATCCCAATCATAGCTCATCCTAATTTTAAACTTGATCTTAAACTGACATTGACTCTGATCTTCACCCTCATCTTGTCACAATCATCCTAATTGGTCTCCTTTAAATGACTTAAATCTGACCCTAAACATAATCCTGACTTTGAAGTTAACATGGGACCCTACTTTGACAACATTACTCTCCAGCCTGGGACTAATCAGTCTAATAACCCATCAGCCCTTTGTCTGGCTGACCTTAATTTCATTGTGTATACCTAAATTGTACACATACACACCATGTTCATCTAAATTTGGTTTATCCACAGAAAGAAGTAATGGCTGAGACTGAATCTTCACTAATCCAGTACTTTTTTCCATATTCCTACTTAGATTCAGCATAAGCATGTGCTTTTGAGAGAGACAAGTTTGCTTCAAGCAGTAAAGATTCTGAAATTTGCAGTAATACTCCTTATGTTCATTTGAAATTTGCCCTCCCTCCCAGTAAGAATATGATTTGAGACAAATGTGTTTTGCTGTGTTTACTTTCATCTCAGTTTACTCTAACAATTAGAAGTTACTTTTGAGAAGAATGTCTGGGAATGGCTAATACAAATACATTTCGGTAGTACTCCGTAGTTTAATCCAGACTCACTCTGACAGTAAGAATGTGAAATACAATACTTACTTTCATCTCAGTTTACTCCAACAAGCTATGAGGAGTCCAGGACTGAATTTGTTGCAGGAAGAGTTCTCATTCAAACTCCTATTCATTGATTCTAATTCCTCCTGCCTCTCAGTAAGAATATGCCTTTGAGGCTAATGTGTTGCATTCCTCATGTTCATGAGTTAACACTAACCAGCTATAAGGTTTAACCCTTGAGAAAACTGTTTGAGACTGAGCTTGTTTGCACTAATAATGATGCTTTCTAATAGCACTAATTTAGATTTGTGCCAATTCACACAACTCACAGTAAGAATGCCATAGAGATGAATGTATGTGGCACTGCTTATCTCTCTTAATTTACACTAACATGCAATTAGGAGTTACATAAATTGAATGATCAAGACAGTTTGATTATACTAATATGGATTCTTTTCATTAACCACTAATTAGACTCATCTTAATTGGTGCTTACTCCCAATAAGAGCTTGCTGTTGAGGTGAATGTATATTGCTGCATTTACGTTTGTCTTTTTCACTAATCCTAACCCAGACCCTGATGTTTAGCCAGATCTAAAGACCCATGATTTTCCCCCCAGTCTGACCTTGAACATGGACCTTAGTGGTCAACCGCTTTACCTTTATCATGATTCCGAAGGTCTTCCTGGACCTCACGTTGACTTCGACACTTCCTAGCCTTGAAATGACCTTGAAACTCTTATTCTGACCATGTCTGACTTTGAAGTTGACCCTGAAACTTTCGTTGTAATTCTGACCATGTCTCATGCTAATTTTAAGTTGACCTTGTACTTTACCTCAGACTGGACCTTTACCATGAACCTGATCTTGACCCACCATGGCTTTGAAATGATCTTGGACTTGATCTTATGAAATTGAACTTGGTCCTGACCCTGATCCAGCTCCTCTCCCTATGACTATCATGTTCCTCTTGAATTGCCCTAATTTTTGAGGACCTGAACTTGACCCCAAATATCATACTAATGTTCATCACAACCTTGGGATAAACTTGGACTTCACCTTAAAATTGACGTTCAGTCTGTTGCTGACAACGAAGGTTAATGCTGAACTTACCCTTGGATTTCATTAAAGTTGACCCTTATCCTGACCCTGATCATTCTGCCAGTGTCTCACACTGAATCACTGATTTTAACCTTGAACTACTTGACTCCAATCCTGCCCTTCGTACACTGGTGATCCTGACCATTATCACCTTGAAGTAACCTTGGATTAACTTTGAAATTGACCTCTATCCACTAATGTTCTGACCATGTCACACCCTTTTTTAAACTTGATCTTGAATATGACTTCACATTGATCTTGAATTTCACACACTGACATTCACTATCTTAACTCCCTGAACTTGGAATGACCGTGAACTTGACCTTGAACTTGAAAGTGGCCCTGAATCAGGTCCTAATTCTAACCTTTGTTTTTACCCTAGCTGTCCTTACTATATTTGCCCTCATTTTTAACTTGTCCTTGAAACTGACCTGGACTGTGATACTGAACCAAACACTGATACTGATGCCTTCATGACCTTGAACCTCATTCTGAAACACCCTGATTATTGTCCTGGCCATGTCATGCCCTAAGTTTATACTTGATTTTGAATCTGTCATCTGTCGCCGACAATTATCCTGATTTTAAGCCGCCCTAAACTTAAAATACCTTTGACCCTGGCCCTAATCCTTAGCCTTGTTCAGACATTTGACGTGATTCTCATCCTGATGCCAAGCAACATCTTGACTGCACCTTTTCCTAAGTATTAACTTGACCTTGAACTTGACCTTAATTCTTGTGATCCTCTTATACTAACAATCTTCCTGACCTTAAAGGGAAATTAGAGTTTTTCCTTGAATCTGACTGATTCTGACCCTGAACATCATTATAACTATGTCCCACTTTCATTTTGAACCTGACCTTGACCCTGCTCTAGCCCCTCACTTTGCCACTGACATCCTGACCTTTCTTGGCCTGATCTTGAAATAGCCTTGCCTTCATACAGCTTCTGCCGCTGTACTGAAAATGACCCATTTTGACCTGGAACCTTACGTTGACCCTAATCTTAACCATCCTTTGTTCACAGGCCATCATTCATACTCTAACCCACCCCAACTATGAAATAATCTTATCCTTGAAATTGACCTTAATACTGACTCTGATACTTACCCCTCCCTCTTACCTTCATCATGACTGATGATCATTGACCAGACCTGCCACACTTTGAACATGATCGTGAAGCCACCTGTGATCCTGACCATGATGTGCCTGTCTAGAGACCTTTTCCTATGTCCCAAACTATTATCACCACCAGATCCCATTTTGTTCTTTTTCATTGGCTCTTCTCTTGAATATGTCCTGTATTAGTTGCTAGGACTGCTATTATGCAAATACCACAGACTGGATAGCTTAAACAACAGAATTTTATTTTCTCACAGTTTTGGAGGATAGAAATCCAAGATCAAAGTGTCGGCAGAATTGTTTTTTTCTGAGGGCCTCTCTCCTTGACTTGTAGATGGGCATATTCTCTCTGTTTTCACATGGTCCTCCCTCTCTGTCTGTGTCCTAATCCCCTGTTCTTTTTAAAATTTTTCAATTACAGTTGACTATGATATTAGTTTCAGTTATCTTCTGCGAACACCAGTCATATTGAGCTAGGGCCCACCCATATGATCTCATTTAACTTAATTACGCCTTTAGAGAGCCTATCTCCAAATATAGTCACATTGCGAGGTACTGGGGGTTAGGGCTTCAACATAGAAATTTAGGAAGGGGACACAATTCAGGCCTTAACATGTCCTATCTACATACTGGCTCCCATGTCTGTCATTAACTTTATTTTGTAAAGCTGGCTTCATGCTAGGTTTCCCCTTTCCTGGCTTGTTTTAATCCTTAAAAATCTTTTAGGGTACAAATTATCCTCAGTAAAGTTGAGGAACCATGTTAATTACTTGCTGAAAGTTGGCTGGAAGAAGATTCCTTTCTCTCAAGCCTGGCTGTATATTGTTGCCAGCTGATGGCCTGGACCCTATCCAGTTTACTGAACTTTACAGCATTAGTGTGGGGCCCAGGTATCCTTTCAAAACCTCTCCACGTGATTCTAATGTGCTGCCACAATTGAACTGTTGTGAAAATATTTCCCTAAATATTTTGAGCTATAATTATGTGTAAGGCTCATTGTCATTTCCTAAAAGAAAATTTAGCCCTTAAAAAAATTAAAGACCTCAAATGTGTGCTCTAACCCTCCCCCTACTGCCACTAAGTTGCAATCTTGCACGTATTTTTGACCCATTTGCCCTACACATATCCAACCAATATTTTAATATTGGAAGATAGTACACAAAATCATTTTGTAGCTGCTCTTAAAAAATTAGAAGAAAATGCAACACTATGATCTCATTCCTGAATTCCTCATAATGATTAGTAATTGACCCACTTCATTTAAAACTGACCTGTCTCCTGTGTTTAAAAAATATATATCAACTTGTGTTACATGTCAATCATATAAAAAAATTCATGATAATAAATAGCAATAGATGGAAACTTCCTCAGCATATTAAAGACCATATGTGAAAACCCCCACAGCCAACATCATACTCAAGATGAAAGACTGAAAGCCTTTTCCCCAAGATCTAAACAAGGGTGCCCCTTTCAACATACTACTGGAAGTTCTATCCAGAACAATTAGGCAACAAAAATAAGTAAAAGGCCTTCAAATTGGAAAGGAAGAAGAGTATCTTGCTTTACAGGTGACACAATCCCTAAAGAATCCACACACAAAACCATTAGAGCCAATAAACTAATTCAGCAACATTGCAGAATGCAAAATCAACACAAAAATCATTTGCATTTCTATACACTGAACGGTCCAAAAAGTGAAGACAATTCTACTTGTTATAGCATCAAAAACATAATATATTAATAAATTAAGTGAAAGATTTGTGAACTGAAAACTATAAAATATTGCTGACAAATTAAAAGACCTAAATA