Transcript asmbl_62367

Sequence
Transcript Sequence for observation asmbl_62367 of TGE0006772:
GCAGCGGGCGCCATGGTGCTGCTGCACGTGCTCTTCGAGCACGCGGTTGGCTACGCGCTCCTGGCGCTAAAGGAAGTGGAGGAGATAAGCCTGCTGCTACCGCAGGTGGAGGAGTGCGTACTTAACCTAGGCAAGTTCCACAACATCGTTCGTCTCGTGGCCTTTTGCCCCTTTGCCTCGTCCCAGGTTGCCTTGGAAAATGCCAACGCTGTGTCTGAAGGTGTTGTTCATGAGGACCTCCGCCTGCTCTTGGAGACTCACCTGCCATCCAAAAAGAAGAAAGTACTTTTGGGGGTTGGGGACCCCAAGATTGGTGCTGCTATACAAGAGGAGTTAGGGTACACTTGCCAGACTGGAGGCGTGATAGCTGAGATCCTTCGAGGAGTTCGTCTGCACTTCCACAACCTGGTGAAGGGTCTGACCGATGTGTCTGCTTGTAAAGCCCAGCTGGGGCTGGGACACAGCTATTCTCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAATATGATTATCCAGTCCATTAGCCTTCTGGACCAGCTGGATAAGGACATCAATACCTTCTCCATGCGTGTCAGGGAGTGGTACGGGTATCACTTTCCTGAACTGGTGAAGATCATCAATGACAATGCTACGTACTGCCGCCTTGCTCAGTTCATTGGGAACCGGAGAGAGCTGAATGAAGAAAAGTTGGAGAAGCTGGAGGAGCTAACAATGGATGGGGCCAAGGCTAAGGCTATTCTGGATGCCTCGCGGTCCTCCATGGGTATGGACATATCAGCCATAGACTTGATAAACATCGAGAGTTTCTCCAATCGTGTGGTGTCTTTGTCAGAGTACCGCCAGAGCCTGCACACTTATCTGCGATCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCCTAATTGGGGAAGCGGTAGGCGCACGTCTCATTGCTCATGCTGGCAGCCTCACCAACCTGGCCAAGTATCCAGCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGGCACTTGCCCACACTCAGGTACCACTTCTGGTGCCCACTGCTTGTTTGGGGATCACAGTGATGGCTGACCAGGGCTTCCTGACCTATACAGGCCTCTGCTATGGGGGTGATGGCCAGTCCTGGTGTCTGAGTGATTCCCAGGGCCCAGCAAAGGGACCGAGTTTCCAGAGCCCTGAAGACAAGGGGTAACACCCCAAAATATGGACTCATTTTCCACTCCACCTTCATTGGCCGAGCAGCTGCCAAGAACAAAGGCCGCATCTCCCGATACCTGGCAAACAAATGCAGTATTGCCTCACGAATTGATTGCTTTTCTGAGGTGCCCACAAGTGTATTTGGGGAGAAGCTTCGAGAACAAGTGGAGGAGCGGCTATCCTTCTATGAGACCGGAATTTTTCCACGGAAGAACCTGCAGGTTATGAAGGAAGCCATGGTTCAGGCAGAGGAGGCGGCTGCTGAGATTACTAGGAAGCTGGAGAAACAGGAGAAGAAACGCTTGAAGAAAGAAAAAAAACGGTTGGCCGCCATTGCTCTTGCATCTCCAGAAAACAGCACTAGTACGCCAGAGGAGTGTGAGGAGATAAGTGAAAGACCCAAAAAGAAGAAAAAGCAAAAGCTCCAAGAGGCTCCTCAGGAGAATGGAATGGAAGAGCCACCTGTCTCTTTAGCCAAACCCAAGAAAAAGAAAGCTTTTTCCAAGGAGGAGCTGATCAGTAGTGATTTAGAAGAAACAGCTGGCAGTGGAAGTCTTCCCAAGAGGAAGAAATCTTTCCCCAAAGAAGAACCAGTTAGTGACCCTGAAGAGGCAGAAAACAGGAGTGTCCCTAAAAAAAAGAGGAAATTTAAGGAGGAGCTGCTCAGCAGTGGACCTGAAGAAGCTGCTAGCAGCAAGAGCAGTAGCTCCAAGAAAAAGAAAAAGCTGCAGAAGCTATCCCAGGGAGATTAGAATGGACAGTGCCCTGGTGGGACATAACCACCCACAGTGACATTTCCCAACCCATCCCTTATATCCCAATAAAAACATTCACAAGCTG