Transcript asmbl_59473

Sequence
Transcript Sequence for observation asmbl_59473 of TGE0003894:
GGAAAAGAGTGGGCTCTGGTGGAGGACAAGGAGGCCTGGGCATTCATCCCTGCTTTTGGCTACCAGACAGAACCAGGCGGCTCTCGGTTCTCCTTTTCTACCCCAGTTGGCATGGGAGTGGAGGCGCCAGAAGAGGGCAACCCCAGCAGGGGTAGGCGCTGTCTTCAGGTCCGGGCCCCTTGGCCTTGACCCAGCCTAGGGCTCGGCCCTCCCCTCCGTGGCCGGGTGACTCAGGCCACAGCTGTTCCCGCGTCACATGAGGGAGGCCGGCGGCCACACGGCCGGGAAGGGGGCTGGGGCTGGAGGCTGGGGCGGGGCCGCGCGGCGGGCGGGGCCGGAGCCGGGGGGCGCAGCTAGAGAGCCCCTGAGCGGCGGCGAGAGAGGATCGCACGGCCTCGAGGAGCCCAGGTCCGGCAGCCATGGCGGTGGAAGGAGGAATGAGATGTGTCAAGATCTTGCTCTACGTTTTTCTGGTGGCTTTTTGCGCCTGTGCAGTGGGACTGATCGTTGTGGGTATAGGGGCCCAGCTCGTCCTGAGTCAGACCATCAGCCAGGGGGCCACTCCTGGCTCCGTCTTGCCTGTGGTCATCATCGCAGTGGGTGCCTTCCTTTTCCTGGTGGCTATTGTGGGCTGCTGTGGGGCCTGCAAGGAGAACTACTGTCTTATGATCACGTTTGTTATCTTCCTGTCTCTTATTGTGCTGGTGGAGGTGGCTGCAGCCATTGCTGGCTATGTGTTTAGAGACAAGGTGATGTCAGAATTTAATAAGGACTTCCGGCAGCAGATGAAGAATTATCCAAAACAGAACCAGACGGCTTTGATCCTGGACAGGATGCAGGAAAATTTCAAGTGCTGCGGGGCAGCTAACTACACAGACTGGGAGACCATGCTTCTTGAGCCCAAAGGCCGAGTCCCTGACTCCTGCTGTATCAATGTCACTCAGGGCTGTGGGATTAATTACAATGTGAAGGAGATCTATACCGAGGGCTGTGTGGAGAAGATTGGGTTCTGGCTGAGGAGCAATGTGCTGGTGGTGGCTGCAGCAGCCCTGGGCATTGCCTTTGTGGAGGTCCTGGGAATTGTCTTTGCCTGCTGCCTTGTGAAGAGTATCCAAAGTGGCTATGAAGTGATGTAGGAGGTCTGGTCTCTTCAGCCCCTCTTCTAGGAGGGTGGGGTAATATACTCCATGTTTTTCAATTAAACGGATTATTTTTTCAGACCG