Transcript asmbl_55538

Sequence
Transcript Sequence for observation asmbl_55538 of TGE0073659:
GTCCTCAAGGCCTGAGGGGCGGGGCTTGTGACCCGCGGAGCCCCGCCCCCTTCAGCCGGAATCTGAATCGCAGGCGTCTTCCGTCCTCCATGGCTGCTGTGCTCCTCGCCTGGGCCTGCGGCCCGGTCCGTAGAGCTCTCTGTCGTCAATTACATACTGTCTACCAGTCTGTGAAACTTCCGGAGACACACCAGATACTGCGTCAGACCTGTCGGGACTTTGCCGAGAAGGAGCTGGTTCCCATCGCAGCCCAGGTGGACAAGGAACACCTCTTCCCAGCAGCTCAGGTGAAGAAGATGGGCAAGCTTGGGCTTCTGGCCATCAATATCCCTGAGGAGTTGAGTGGTGCCGGACTCGATTATCTGGCGTACGTCATCGCCATGGAGGAGATCAGCCGGGGCTGTGCCTCCACTGGAGCCATCATGAGTGTCAACAACTCCCTCTACTTGGGGCCCATCTTGAAGTTTGGCTCCAAGGAACAGAAGCAGCAGTGGATCACACCTTTTACCAGCGGTGACAAAATTGGCTGCTTTGCCCTCAGTGAACCAGGGAATGGCAGTGACGCAGGAGCCGCCTCCACCACTGCCCAGGAGGATGGTGACTCGTGGGTCCTGAATGGCACCAAAGCCTGGATCACTAACTCCTGGGAGGCCTCAGCCACCGTGCTTTTTGCCAGCACCAACAGAGCCTTGCACAACAAGGGCATCAGTGCCTTCCTGGTTCCCATGCCGACACCTGGGCTCACACTGGGGAAGAAGGAAGACAAGCTGGGCATCCGGGCCTCGTCCACAGCCAACCTCATCTTTGAGGACTGTCGCATCCCCAAGAACAACCTGCTGGGGGAGCCGGGAATGGGCTTCAAGATAGCCATGCAAACCCTGGACATGGGCCGAATTGGCATTGCTGCCCAGGCTCTGGGCATCGCCCAGGCTGCCCTCGACTGTGCTGTGAACTATGCTATGAATCGCAAGGCCTTTGGGGCGCCCCTCACCAAGTTCCAGGGCATCCAGTTCAAGTTGGCGGACATGGCCCTGGCCCTGGAGAGTGCCCGGCTGCTGACCTGGCGCGCCTCCATGTTGAAGGATAATGGAAAGCCTTTCATCAAGGAGGCAGCAATGGCCAAGCTGGCTGCATCAGAAGCTGCAACTGCCATCAGCCACCAGGCCATTCAGATCCTGGGTGGCATGGGCTACGTGACAGAGATGCCGGTCGAGCGGCACTACCGTGATGCCCGCATCACCGAGATTTACGAAGGCACCAGTGAGATCCAGAGGCTGGTCATCGCGTCGCACCTGCTCAAGAGCTACCAGAGCTGAGCCCTGAGGATTGGGTGGGGGCCAGAGTAACCAGGCCTCAAAGTAGCAGAAGTTGTGCTCTCTCAGGCCTTGTGAAGGCTGTGAGGCTCGGTCATTATTAGAAGCACCGTTAACCTGTTCCTTATAAAACATAAATGAGTGCAGGTGGGTGGTCTGATTCATAGTTTGGGAACTGATTGTAAGTAATAAAGCATACCCGTTCCCCTA