Transcript asmbl_55450

Sequence
Transcript Sequence for observation asmbl_55450 of TGE0003804:
TGGCTCCGCCCCTCTACCCGGCCCAAGGTTCTTATTGGTCAGACGTCTTCGGCCCCATCGGTCCTAGAGACACAGGGCTGGGTCTGTCCCAAGATATGCCTGCTTCCGGAGCCGCAGTAAGGACGGTCAGTTGCGTTGCCGCTTTCAGGCATCCGTTTAGGACAGCCCCATGGGGCCTGAAGGGGCTTCGTATGGCAACCGGTACAGTTGAGAGTTCAACGGCGCGTTGCAAAGATGCCGCCCAAAGGAAAAAGCGGTTCTGGAAAAGGGGGAAAAGGGGGAGCAGCTTCTGGGAGTGACACTTCTGACAAGAAGTCTCAGGGTCCCAAAGGTGGTGGCAATGCAGTAAAGGTCAGACACATTCTGTGCGAAAAACACGGGAAAATCATGGAAGCCATGGAAAAGCTGAAGTCTGGAATGAGATTCAATGAAGTGGCCGCACAGTACAGTGAAGATAAAGCCAGGCAGGGGGGCGACCTGGGCTGGATGACCAGAGGGTCCATGGTGGGGCCATTTCAAGAAGCAGCATTTGCCTTGCCTGTAAGTGGGCTGGACAAGCCTGTGTTTACAGACCCTCCGGTTAAGACAAAATTTGGATATCATATTATTATGGTTGAAGGGAGAAAATAAAACTATCGCAAGACCGAA