Transcript asmbl_54887

Sequence
Transcript Sequence for observation asmbl_54887 of TGE0003793:
CTGGGCTTGGGTTTCCCGGTTGGCGGGCTTGACAGACAGTGAGAGGAGCCGGATTCTGGGCCTGCAGAGGGCGAGGCTTGTGCTTGACAGGCAGGGTCAGGCAGGCGTTTGATAGGCAGGGGACGGGCCCTGGAGACTGGCAGGCCAATCGGCACGCGGGGTCGGGGCCTGCGCCAGCGCCATCCGACCCAGGCTCCTGCGGTGCTTCACAGTCTGGCTCCGGCGCCGCCCGTCGCGGTCTCGGTTCTGCTCAGCCCGCCTCTGCTCCTGCTCGGCGTCCGGGCTCCCTGTCCGCAGCCATGAACGCTCTCCTCCCGAGTCGAGCCCGCTGTCTTCTAGATTAGTCCCCGCTGCCGTCCCTGGACCGCCTGCACCATGGAGTCGCCCGCCTCGAGCCAGCCTGCCAGCATACCCCAGTCCAAAGGAAAATCTAAGAGGAAGAAGGATTTACGAATATCCTGTGTGTCCAAGCCACCTGTGCCCAACCCTACGCCACCCCGGAACCTGGACTCCCGGACCTTCATCACCATTGGAGATAGGAACTTTGAGGTGGAGGCTGATGACCTGGTGACCATCTCGGAACTGGGACGTGGAGCCTATGGGGTGGTAGAGAAGGTGCGGCATGCCCAGAGCGGCACCATCATGGCTGTAAAGCGGATCCGGGCCACTGTCAACACACAGGAGCAGAAGCGTCTGCTCATGGACTTGGACGTCAACATGCGTACAGTCGACTGCTTCTATACTGTCACCTTCTATGGAGCCCTCTTCAGAGAGGGAGATGTATGGATCTGCATGGAGCTCATGGACACATCCTTGGATAAGTTCTACCGGAAGGTGCTTGATAAAAACATGACGATTCCAGAGGACATTCTTGGGGAGATTGCTGTGTCTATTGTGAGGGCACTGGAGCATCTGCACAGCAAGCTGTCCGTGATCCACAGAGATGTGAAGCCATCTAATGTCCTCATCAACAAGGAGGGCCATGTGAAGATGTGCGATTTTGGGATCAGCGGCTACTTGGTGGATTCTGTGGCCAAGACGATGGATGCTGGCTGCAAGCCCTATATGGCTCCTGAGAGAATCAACCCGGAGCTGAACCAGAAGGGCTACAACGTCAAGTCTGATGTCTGGAGCCTCGGAATCACCATGATCGAGATGGCCATTCTACGGTTTCCTTATGAGTCTTGGGGGACCCCGTTCCAGCAACTGAAGCAAGTGGTGGAGGAGCCGTCCCCCCAGCTCCCAGCTGACCGTTTTTCCCCTGAGTTTGTGGACTTCACCGCACAGTGCCTAAGAAAGAACCCCGTGGAGCGCATGAGCTACCTGGAGCTGATGGAACATCCTTTCTTCACCTTGCACAAAACCAAGAAGACAGACATCACTGCTTTTGTGAAGGAAATCCTGGGAGAGGACTCATAGGGGGCAGGGCCTCGGACCCCACTCTGGCCCTCTAGTGCCCCACAGCCCCCTCTGCTGGAGCAGTGCTTGCCCACACCTATAAGCTACTGCCACCCTGGCCTTGGGCATTCCAAGAGGAATCGAGGGGGCTGCTCCCAAGTGCCAAAGAACCAGACTGTCGGGGCCCCCCGCTGGGCCCATGCGGGCCCCACCAGTGCCTCTGTCCTGCTGTTCCAAGTCTCCAGCCCTGAGGCCTTGGACTTGGAGGGGCCTGGATGCCCCTGCCAGACGCTGCTGCCCCTCACAGAAGGCATCCGGTGCTTGTGCACAGGCCACTGCCTTGGCCCAGCCCTGGATGCCACCTGAGTTGTATATTTTTGTATCTTTCGACTGAATGAACTTTGCACACTTCAAGGGTGGCCACACATCTCTCCCAGCATCAGTAGAGGGGACATGGGGATGAGCCACATGAGTCCTCCTGATCCCCCTCTGAGGGAGAAGCCAGAGCCACTTGAGGCCTTCACCCAGCACTGGCAAATGGCCTCTAAGGGGCACCAAGGACACTTAGCCTCTGCCTGCCACCTCTAGGGGTGTTGTTTCACTTTTTAAAAACAAATTTGTCTTTTTTTTTCTTTTGCTTTGTGGGTTTGGCTGGTTTTTCTCGCATGGTTTGGAGCCGATAACTTTTCTGCCACTCCCTAGGGGACCAGCAAGCTGAGACCCACCCTCTCCACTCAGGCTGGAGTCTAGGAGGATGAGCCCAAAGTCTCTGCTTAGAGAGGTATTCTTCTTGGGGATTGGCTTGACAGGGGCTATAGATTTGCTTTTGGTGTTAGAAAAGAAAAAAATGTTTTGAAGGACTACCTGTTCTGGGTTCTATCCCTGGTGGATTGGGGCAGTTACATGATTGCTGTTTTGATTT