Transcript asmbl_61044

Sequence
Transcript Sequence for observation asmbl_61044 of TGE0006720:
TTTTTCCTTTGGTGTTCCCTAACGGGGAGCATGGGCTGAGCTGGCCTTGTCACCGCCAGGGGGCTCGGCCCAGGCGCAGAGTGGACCCCCTATTTTCTGTCCGACATGCCGGCCAGAAGTGAAATGTCTGCTGGGTGCGAGGCTCGCTCCTCCTCCCTGTCTTAAAGCCTCATCCTCTCCCCGACTCAGGAGCTGGTTTTCCATCTGCCCCCGTCGGCAAGAGCCCCATGGTGGAGCAGGCTGTCCAGACCGGTTCCCTCGATAACCTGAATGCCAGGAAGCCGTCGCCCGGCAAGGGCACAGTGGGGATGCAGCTCAACGGGCGCCCGACCCCGCCAGGCAGCAAGAGCGCCAGCGATGTAGCCCAGCCGGCCACAGTGCAAACCCAAGGGCAGGTGAACGACGAAAACAGAAGGCCCCAGAGGAGGAGATCAGGGAATAGACGAACCAGGAATCGCTCCAGGGGGCAAAGCCGCCCAACTCACGTCAAGGAGAATACCATCAAGTTCGAAGGCGACTTTGATTTTGAGAGTGCAAACGCCCAGTTCAACCGTGAGGAGCTGGACAAGGAGTTTAAGAAGAAACTGAATTTTAAAGATGACAAAGTGGAGAAAGGGGAGGAGAAGGACCCGACACTGGTGACCCAGAGTGACGAGGTGCCAGCCGAGGAGGACCACCTGGGGCCCAACTGCTACTACGACAAGTCCAAGTCCTTCTTCGACAATATCTCCTCTGAACTCAAGACCAGTTCCAGGAGGACCACATGGGCCGAGGAGAGGAAGCTCAACACGGAGACCTTCGGGGTGTCGGGAAGGTTTCTCCGTGGCCGCGGTTTCCGGGGCGGATTGCGAGGGGGCAGGGGCACCGGTACGACCCGGCGCAACCCTACTTCCCACCGAGCTGGGACGGGCAGAGTGTGAGGGGGCAGCCAGAGGCTCCTGCCGAAGCAGCGGAGACGAATCTGTGAGGGCCACGGAGGACGCCGCATTTACGGGAGACGCTGGGCCCCTCTGTTTACTGTTTGCAGAATTCCCACGTGCTACTTTTGTTCTGGACTTCACGCGACTTGGACGTGGTCTGAGTTGGAACCACTTGTTTTGGGGAAGTGTTTATGGGAAGCCTCTCCGGGGCATCAAGATCTTTTGTTCTTACTTGCACACAGTGTAATCTAAGGTTTTGGTATTTTGCAAAGAGGTTTCTAGAACGAAAGCTCGATTCTCATTTCGTGACTTTTTTTTGGCCGCTTTGACTTTGAAAGTGGAACCAAATCTCCTTGGGCAGTGTGGCAGCCGGGCGCGGCTCTGTAATCCAGCTGGCCCCTGGTGTTGCTGGCCTGGCACCCCCGTGCCAGGTGGGGTCTCAGGAGCCAGGCAGGGCCAGCACAGGGGTGAGGGGG