Transcript asmbl_44504

Sequence
Transcript Sequence for observation asmbl_44504 of TGE0003675:
CGTCTTCCTGTGACCTCTAGACCCCTTTGCCACTTAAGAATTCTCTATTACGATTGTGTTAATTCTTCAGGGCCAAGACTGTATGTTACATTTGATTCTCCAAGGTTTCCAATATTTATCAGGAGTCCAGTACCCTTCCACTGGGTGACTACACTGCCCTCGGGCCGACTACGTGGAAGCTAAGGAAGCTTAAACGAAGCGACAACACGTGAACCGCGCGTTTTAGGAAGACGGTGCGCAGAACAGTGCCTGGAACAGTCTGAAATTCTAACAACTCTCCCATTTGGAGAGGCGTCCGGAGGGGTTTTCTGAGGTTACTTCTCTGAGCATGAGCGGAAGTCACGTTTTGACCAGTCTGTGGGGGGTTTTTACTGATAGGTGCCATATTCAGGACAGAGCAATTCATTTCTATTCTGTTCTCCCCGTTGTACCCACAAGCAGGTGACAAGTTCGTCTTCGCTACTAGACGATAAAGACAGCATTCAAGGAAGTCGTAAGGCAGCACGACTCCCCATCTTCCCATAGTAAAGATGGAGGCGCCCTGCATGTAAACGACAGGTAAAACTACTTCCGCCTTTCTCCTGCGCCCTCGTCCAAGATGGCGGACGAGGCCACCCGGCGTGTCGTGTCTGAGATCCCGGTGCTGAAGACTAACGCCGGACCTCGAGATCGGGAGTTGTGGGTGCAGCGACTCAAGGAGGAATACCAGGCTCTTATCCGGTATGTGGAGAACAACAAGAATGCGGACAATGATTGGTTCCGACTGGAGTCCAACAAGGAAGGGACTCGGTGGTTTGGAAAATGCTGGTACATCCACGATCTCCTCAAATATGAGTTCGACATCGAGTTTGACATTCCTATCACATATCCTACTACTGCTCCAGAAATTGCAGTCCCTGAGCTGGATGGAAAAACAGCAAAGATGTACAGGGGTGGCAAAATATGTCTGACCGATCATTTTAAGCCTTTGTGGGCCAGGAACGTGCCCAAGTTTGGATTAGCTCATCTTATGGCTCTGGGGCTGGGTCCATGGCTGGCAGTGGAAATCCCCGATCTAATTCAGAAAGGCGTGATTCAGCATAAAGAGAAATGCAGCCAATGAAGGATCAAGCCGCTGAGGCTGAGACTTGGATAGGCTACGTTCCTGTTTTCCTGTGCATCCCTCTTCTTACTCATCCGACCGCTTCACTCACACCCCTTCGCCTACAGCGGTTACTAAGTAGCTGCAGCGGTACAGTTTCCAGCATTGCCGGGGTGAAAAAACAGTGTTGCTACTGAGTTTCTAAGTTAGGCTGTACAGGGAGGGGAGAGGCTGGGGCTTTGGAAAAACCGAAAGGTAATTTATACCCCTTCCCCAGGCGGAGCGGTGTGAGATCCTGGAAGGACAGGGGATGGTTGAAAGTGGGTACACAGTCTTTTTGGTTTCCGGAAATAACTCATCAATAAAAGCTGCTTCTTCTGGTG