Transcript asmbl_44175

Sequence
Transcript Sequence for observation asmbl_44175 of TGE0003645:
GGTGGCCAGTGCGCATGCGTAACACGGCTTGACAGAGCGCGGAGGAAAAATCCGCGAGAAGGTGGTGGAAGAAGATGGCGGTGCTAGGGCCGAGTTTACAATCTTTTTGAATAGACTAGTCCAGTAACTGTTCGGGTCATGGCGTCAAACTCAACTAAGTCTTTCCTGGCAGATGCAGGCTATGGAGAACAGGAGCTGGATGCTAACTCTGCCCTTATGGAATTAGACAAAGGTCTGAGATCTGGCAAACTTGGTGAACAGTGTGAAGCAGTTGTTCGCTTTCCCAGGCTCTTTCAGAAGTATCCATTCCCTATTCTCATCAATTCTGCATTCCTAAAGTTAGCTGATGTTTTCAGAGTTGGAAACAATTTCCTGAGGCTCTGTGTTCTTAAAGTTACTCAACAAAGTGAGAAGCATTTGGAGAAAATTCTAAATGTGGATGAATTTGTGAAGAGAATTTTCTCTGTGATTCATAGTAATGATCCTGTAGCAAGAGCCATCACACTCCGCATGTTGGGAAGTCTGGCATCAATAATTCCTGAAAGGAAGAATGCTCACCATAGTATTCGTCAGAGTCTGGATTCACATGATAACGTAGAAGTTGAAGCTGCTGTTTTTGCTGCTGCAAACTTCTCTGCACAGTCAAAGGATTTTGCTGTAGGAATCTGTAACAAAATCAGTGAAATGATTCAAGGCTTAGCCACACCAGTAGACTTGAAGCTAAAGTTGATCCCAATCCTACAGCACATGCACCACGATGCGATCCTGGCTTCCAGCGCTCGTCAGCTGTTACAACAGCTAGTCACGTCCTATCCTTCTACCAAAATGGTGATTGTTTCTTTGCACACTTTTACTCTGCTTGCAGCTTCATCTTTGGTGGATACACCTAAGCAGATTCAGCTTCTCTTACAGTATTTGAAGACTGACCCCAGGAAAGCAGTAAAGAGACTTGCTATTCAAGATCTGAAATTACTTGCCAATAAAACACCGCATACTTGGACTAGGGAAAACATTCAGGCACTCTGTGAATGTGCCCTCCAGACTCCTTATGACAGCTTAAAACTCGGGATGTTGTCTGTCCTTTCCACACTGTCAGGGACTATCGCTGTCAAACATTACTTCAGCATAGCTTCGGGAAATGTGGGTTCTTCGCCTAGATCCTCTGATTTAGTCAAATTAGCCCAAGAGTGCTGTTACCATAATAACAGGGGCATTGCAGCTCATGGAGTCAGAGTACTAACTAATATAACTGTTTCTTGTCAAGAAAAAGACCTTTTGGCACTGGAACAAGATGCTGTTTTTGGCCTGGAAGCCCTTCTGATACTTTGTAGTCAAGACGATAGTCCAGGTGCTCAAGCCACTTTAAAGATTGCTCTGAACTGTATGGTGAAGCTGGCCAAGGGCAGACCCCATCTTAGCCAGTCAGTGGTTGAGACCTTGTTGACTCAGTTGCACAGTGCTCAGGATGCTGCCCGGATCCTGATGTGCCATTGCCTGGCTGCCATTGCCATGCAGCTGCCGGTGCTGGGTGATGGAATGCTGGGTGACCTCGTGGAACTCTACAAGGTGATTGGACGATCAGCCACAGACAAGCAGCAGGAACTTCTGGTGAGTTTGGCCACTGTGATTTTTGTCGCCAGTCAGAAAGCACTCTCTCCTGAGGTAAAGGCAGTAATTAAACAGCAGCTCGAAAGTGTCTCCAATGGGTGGACTGTGTACCGAATCGCCAGACAGGCATCCAGAATGGGTAATCATGACATGGCCAAAGAGCTTTATCAGAGTTTGCTGACTCAGGTTGCCTCAGAACATTTCTACTTCTGGCTGAATAGTTTGAAGGAGTTCTCACATGCAGAACAGTGTCTCACTGGATTGCAAAAGGAAAATTATAGTTCAGCACTTTCTTGCATTGCTGAGTCTTTAAAATTCTACCACAAAGGGATTGCATCCCTAACGGCTGCCAGTACACCACTGAATCCTTTAAGTTTTCAGTGTGAATTTGTAAAACTCAGGATTGACCTTCTACAAGCCTTCTCGCAACTTATCTGTACTTGTAATAGCCTAAAGACAAGCCCCCCACCTGCAATTGCCACAACAATTGCCATGACCTTAGGGAATGACCTTCAGAGGTGTGGTCGCATCTCCAATCAGATGAAACAGTCCATGGAAGAATTCCGAAGCCTTGCTTCCCGATATGGAGATCTTTATCAGGCATCTTTTGATGCCGATTCAGCAACTTTGAGAAATGTAGAGCTACAGCAGCAGAGCTGTTTGCTGATATCTCACGCAATAGAAGCTCTGATTTTGGACCCGGAATCTGCAAGTTTCCAGGAATATGGATCTACTGGAACAGCCCATGCTGATAGTGAATATGAGAGAAGAATGATGTCTGTGTATAATCATGTCTTGGAGGAGGTGGAATCACTCAATCGGAAATATACCCCTGTTTCTTATATGCATACAGCATGCCTCTGCAATGCCATCATTGCTTTGCTGAAAGTTCCTCTTTCATTTCAGAGATATTTTTTCCAGAAACTGCAGTCTACCAGCATTAAGCTTGCTCTGTCACCATCCCCACGGAACCCTGCAGAGCCCATCGCTGTCCAAAATAACCAGCAGCTGGCGCTGAAGGTGGAGGGAGTGGTTCAGCATGGATCCAAACCAGGACTTTTTCGCAAAATTCAGTCTGTCTGTCTGAATGTTTCTTCCACGCTACAGAGTAAATCTGGACAAGACTACAAGATACCCATCGACAATATGACCAATGAGATGGAGCAGAGGGTTGAGCCTCATAATGATTACTTTAGTACTCAGTTTCTGTTGAACTTTGCTATCCTTGGAACACACAATATTACAGTGGAATCTTCAGTGAAAGACGCCAATGGTATTGTATGGAAGACTGGTCCCAGAACTACCATATTTGTCAAATCCCTGGAAGACCCTTATTCCCAGCAAATCCGCCTACAACAGCAGCAAGCCCAGCAGCCATTACAACAGCAGCAGCAACGGAATGCCTACACGCGATTTTAGCCACGTGACGAGTGTACTACAGGCTTTACAGGAATCGATGAAATTGTCAAAAATAGTTTGCTTTTCCACATGGATTAAGATATGAAAGTTTTAACGCAGACTCTGTTTACTCATTGGTTTCTGCAATGTAATCTGAAAAATGATTTTTTTTACCTTAAAAATTTCATTCGAGAGATATTTGGGTTACTAACCAGAAAGATTTTTTTCCCTTGTTCCTTTAACCAAGTCCTTTATCTCATATTTAACATTTTCATTCTTTTATTAGTGTTTTTACTGCTGCTGAGCCTTTTCTTTTTCTTTCAAGAAAAGTCACATATTGGGATCACTGAATTAGTAAATTTGACTGTTTCTCTACCAAAATATACTACTTGCTGCTTGACACAGGCCTGTAATTCTGAGCTATGCCTTGGGGAGTTCTGACCAGTAGGGTACAGGGTTCACCCGTAGTAGAAGAAACTGAGTCTTCCCGTGGGTGGACTTAGAAATGTCCCCTGAAACGTCCAGTTTCTGGGTTACGAGAGCAGGCAGTCTAGCAGAATTGAGACATCCTGCTATACATATTATTTCAACTACTTACCTATCTGTTCTGTGCTAAAGCAATCTTAATTTATTGTTTTAGTATTTAATTGACCCAAAGAGCAGCTAGCAATTACATAGGAAGATTTGGAGATTAATAATTTTTTTTTTATTATGCGTGTGATTGTGTAGACTTTGTACATTGTTTCTAAGAGTGAAAAAAATCACTCACATTTAATATCTTATTGTTTTAAGGTAGGAGGGCAGATCTTTTCCTTTGATTGATTTAGTTTCTTCTTGGCAAGTTCTGTAACGCTAGACTTGATTGTCTAGAAAGGACCGTCTCCTTATAACCAACCTCAATTAGTTGAGATGCTCAGGGAATAGAAGTTTTCTGGTTAGCCAGAAAACTCCTTTTTTCTATTTCAATACTGGCTGAAAACCATTGTAAAATCTAATAATAGTATGCTTTCTTGTCTTAACACAGTGCAGTAGATAAAATTTAACTATTCTTTCTTGATTTGGGATCAGTCAGTGCTTTGGGATCATGATTTCTAAACATCAGGGATCACAGATTGCAGATATCGATGATATGGTCACTTAGGCTGGAATCAGCTCTGAATGTGAAGCAGACACATTCCTTGGAAGTTTCTTTTTAAAATAAATCTCTCAATTTCA