Transcript asmbl_60997

Sequence
Transcript Sequence for observation asmbl_60997 of TGE0006711:
GGCGGTAGCGGCGGGAGCCGAGGCTTGCAGCGGGACTCCCCGCTGAGAGCGCGACGCGGCCTTGAGCGGCAGACGGCGCAGTAGGCCGAGGGGGAGGCGCGGCAGCCGCCCTGGCCCGTCATGGAGATGGAAAAGGAGTTCGAGCAGATCGACAAAGCCGGGAGCTGGGCGGCCATTTACCAGGATATCCGACACGAAGCCAGTGACTTCCCGTGTAGAGTGGCCAAGCTTCCCAAGAACAAAAACCGAAACAGGTACAGAGATGTCAGTCCCTTTGACCATAGTCGGATTAAACTTCATCAAGAAGATAACGACTATATCAACGCTAGTTTGATAAAAATGGAAGAAGCCCAAAGAAGTTACATTCTTACCCAGGGCCCTTTGCCTAATACGTGCGGCCACTTCTGGGAGATGGTATGGGAGCAGAAGAGCAGGGGCGTGGTCATGCTCAACCGAGTGATGGAGAAAGGATCGTTAAAATGTGCGCAGTACTGGCCACAAAAAGAAGAAAAAGAAATGGTCTTTGAAGACACAAATTTGAAATTAACATTGGTCTCCGAAGATATTAAGTCATATTATACAGTACGACAACTAGAATTGGAAAACCTTTCATCTAAAGAAACTCGAGAGATCTTACATTTCCACTATACCACGTGGCCTGACTTTGGAGTCCCCGAATCTCCAGCCTCTTTCCTGAACTTTCTTTTCAAAGTCCGCGAGTCGGGGTCACTCAGCCGGGAGCATGGCCCCATCGTGGTACACTGCAGCGCTGGCATCGGCAGGTCGGGGACCTTCTGTCTGGCCGACACCTGTCTCTTGCTGATGGACAAGAGGAAAGACCCTTCTTCTGTCGATATCAAGAAAGTCCTGTTAGAAATGAGGAAATTTCGAATGGGACTGATCCAGACAGCAGACCAGCTCCGTTTCTCCTACCTAGCTGTGATCGAAGGTGCCAAATTCATCATGGGAGACTCTTCAGTGCAGGAGCAATGGAAGGAGCTCTCCCACGAGGACCTGGAGCCCCCACCTGAGCATGTCCCCCCACCTCCCCGGCCACCCAAACGAATCCTGGAGCCACACAATGGGAAATGCAAGGAATTCTTTCCAAACCACCAGTGGGTAAAGGATGAGTCTGAGGAAGATAAAGAAGATGGCCCCATCAAGGAAGAAACCATAACACCCTTAAGTGTCCCCTGCATGGAACGCACGAGTCAAGACACTGAAGTCAGAAGGCGGGTCGTGGGGGCAGGTCCTGCTCAGGGGGAGCCGTCGCCACCCAAGGAGGAGCAGGACCAGGCTCTGACTCACTGGAAGCCCTTCCTGGTCAACATGTGCATGGCCACGGTCCTCACAGCTGGCGCGTACCTCTGCTACAGGGTATGTTTTCACTGACGGACGTGCCGGCAAGACCACGTGTACAGAAAGCACTGGCCGACAGCCTGGCGGTAGCATTCAGTGCTGTGCAAGGATCTGAGCCAGTCTCAGAAGAAACAGATCAAAGTTTTTTAAAGTCTGGAACTGTGAAGGGCTAACAAGAGAGAATTGAGGATTGATGCACTGGGGTTTTAAGGAGCCCTGTGGTCCCAAGAATACAACAGTCTAATCTCAGGGCCTTAACCTATTCAGGAGTAAGTAGAGAAAATGCCAAATACATCTCTCTCTCTTCATTTTTCTTTCTTTCTTTTTCTTTGTTTTTTTTTGTTTGTTTGTTTG