Transcript asmbl_43825

Sequence
Transcript Sequence for observation asmbl_43825 of TGE0003617:
GGGGCCAGGGCGGCCGCCTAAGCTGGAGCTGTAGTTGTGCAAATAGCTCCCGCGGCCCCTGCGAGGGTGACACACTATGATCACGGCCCCTAGAGACCGTCGTGCTGGCAAGCAGCACACCCTAGCTCCCCGGTCTGCCTCGGCCACCTCGGCAGCGCTCGAAGCCAGCAGCAGGAGTTGAGCTGCCCTGCGCCCGAGGGTTTTGGCGAAGCCCTTGGTGGCGCGCTGAGCACAGGAGGACGAAGAGGCTGAGCGTGCGCTCCTGGGTCAGGCGGTCGGCTGGGGTCGCCGCTGGAGGGGCGTTTCCGAGGAGTGGAGGAGGAGGAGGAGATGCTGCTCCTCTTCTCGCCCTCCCCAGGCTCCTTCTCCAGCTCCGCCGTCCCACACCCGCAGCCGTTTGGGGGAGAAGAGGTGGTGGCTCTCGGCGCCCGCGGCGGCTGCCCGCGGCCCGCCCCGACGCCGCGTCCCCGCAGCCCTCGCCCCGCGCTCCCGTAGCAGGACCGGGTCTGCGGCAGCGGGGTAACATGCATGTGTCACTAGCTGAGGCCCTGCAGGTTCGGGGAGGACCACTGCAAGAGGAAGAAATATGGGCCGTATTAAATCAAAGTGCTGAAAGTCTCCAAGAATTATTCAGGAAAGTAAGCATAGCTGATCCTGCTGCCCTCGGCTTCATCATTTCTCCGTGGTCTCTGCTGTTGCTGCCATCTGGTAGTGTGTCATTTACAGATGAAAACATTTCCAATCAGGACCTTCGAGCGTTCACTGCACCGGAAGTTCTTCAAAATCAGTCACTAACGTCTCTCTCAGATGTTGAAAAGATCCATATTTATTCTCTTGGAATGACATTGTATTGGGGGGCTGATCATGAAGTACCTCAGAGCCAACCTATCAAGCTTGGAGATCATCTCAACAGCATACTTCTTGGAATGTGTGAGGATGTTATTTACGCTCGGGTTTCTGTTCGGACGGTCTTGGACGCCTGCAGTGCCCACATTAGGAACAGCAATTGTGCACCTTCATTTTCCTACGTGAAACAGTTGGTAAAACTGGTTCTGGGAAATCTTTCTGGGACGGATCAGCTTTCCCGTAACAGTGAACAAAAGCCTGATCGAAGCCAGGCTATTCGAGACCGATTGCGAGGAAAAGGATTACCAACAGGAAGAAGCTCTACTTCTGATGTACTAGACATACACAAGTCTCCATTCTCTCATCAGACCTTTCTTAACAAAGGGCTTAGTAAATCTATGGGATTTCTGTCCATCAGAGATACACAAGATGAGGAAGACTATTTCAAGGACATTTCATCAGATAATAATTCTGGACATGAAGATTCTGAAAATACCTGCCCTCCTTACCAGTTCAAAACTAGTGGCCCAGAAAAAAAAGCTCTTCCTGGCTCCGATGTCCTATCCAAGAAGAAGATCTGGGCTTCATCCATGGACTTGCTTTGCACAGCTGACAGAGACTTCTCTTCTGGGGAGACCTGCAGATATCGACACTGTCTCCCTGAGGCAGTAGCAGTGCGGTCTTCAACTGCTCCTAGAAAAAAGGAAGCAAGATACTCAGATGGAAGCATAGCCTTGGATATCTTTGGCCCTCAGAAAATGGATCCTATATTTCACACACGAGAATTGCCCACCTCCTCAGCAATATCAAGTGCTTTGGACCGAATCCGAGAGAGACAAAAGAAACTTCAGGTTCTGAGAGAAGCCATGAATGTAGAAGAAACACCTCGAAGATACAAAACTTACCACGGTGATATCTTTAGTACCTCCAGCGAAAGTCCATCTATTATTTCCTCTGAATCAGATTTCAGACAAGTGAGAAAAAGTGAAGCTTCAAAGAGATTTGAATCCAACAGTGGCCTCCCAGGAGTGGATGAAACTCCAAGTCAAGGCCAGTCACACAGACCAAGCAGACAATATGAAACACCCCTTGAAGGCAACTTAGTTAATCAGGAGATCATGCTAAAACGGCAAGAAGAAGAAATGATGCAGCTCCAAGCCCGAATGGCCCTTAGACAGTCTCGGTTGAGCCTGTATCCGGGAGATACAATCAAAGCTTCCATGCTTGACATCACCAGGGATCCATTAAGAGAAATGGCCCTAGAGACAGCCATGACACAAAGAAAGCTGAGGAATTTCTTTGGCCCCGAGTTTGTGAAGATGACAATTGAACCATTTATATCTTTGGATCTGCCACGGTCTATCCTTACCAAGAAAGGGAAGAATGAGGATAATCGAAGAAAAGTAAACATAATGCTTCTGAATGGGCAAAGACTGGAACTGACTTGTGATACCAAAACTATATGTAAAGACGCGTTCGATATGGTTGTGGCCCATATTGGCTTAGTGGAACATCATCTGTTTGCTTTAGCTACCCTCAAAGATAATGAATATTTTTTTGTTGATCCTGATTTGAAATTAACCAAAGTGGCCCCAGAGGGATGGAAAGAGGAACCAAAGAAAAAGAACAAAGCCACTGTTAATTTTACTTTGTTTTTCCGAATTAAATTTTTCATGGATGATGTTAGTCTAATACAACATGCTCTGACCTGTCATCAGTATTATCTTCAGCTGCGAAAAGATATCTTGGAGGAGAGGATGCACTGTGATGATGAGACTTCTTTGTTGCTGGCATCCTTGGCTCTCCAGGCAGAGTATGGAGATTATCAACCTGAGGTTCATGGTGTGTCTTATTTTAGACTGGAGCATTATTTGCCTCCCAGAGTGATGGAGAAACTTGATTTATCATATATTAAAGAAGAGTTACCCAAATTGCATAATACCTATGTGGGAGCTTCTGAAAAAGAGACAGAGTTAGAATTTTTAAAGGTCTGCCAAAGGCTGACAGAATATGGAGTTCATTTTCACCGGGTGCACCCTGAGAAAAAGTCGCAAACTGGAATATTACTTGGAGTCTGTTCTAAAGGTGTCCTTGTGTTTGAGGTTCACAATGGAGTCCGCACACTGGTCCTTCGCTTTCCATGGAGGGAAACCAAGAAGATTTCTTTTTCGAAAAAGAAAATCACATTGCAGAATACATCAGATGGAATAAAACATGCCTTCCAGACAGAAAACAGTAAAGTATGCCAGTACCTGCTGCACCTCTGCTCCTCCCAGCATAAGTTCCAGCTGCAGATGAGAGCAAGACAGAGCAACCAAGATGCCCAGGATATTGAGAGAGCTTCGTTTAGGAGCCTGAATCTCCAAGTGGAGTCCGTTAGAGGATTTAATATGGGACGAGCTATCAGCACTGGCAGTCTGGCCAGCAGCACCCTGAACAAACTTGCCGTTCGACCTCTGTCAGTTCAAGCTGAGATCCTGAAGAGGCTATCCTGCTCAGAGCTCTCGCTTTACCAGCCATTGCAAAACAGTGCAAAAGAGAAGAGTGACAAAGCTTCATGGGAGGAAAAGCCTAGAGGAATGAGTAAATCATATCATGATCTCAGTCAGGCCTCTCTCTATCCTCATCGGAAAAATATCACTGTTAACATGGAATCACCACCACAAGCCATTGCGGAGTTGGTAGGAAAACCATTTCACCAGATGGCAAGATCTGATACAGAATCTTTGGCAGGACTCACAAAACTTAATAATTCAAAGTCTGTTGCAAGTTTAAATAGAAGTCCTGAAAGGAGGAAACATGAATCAGACTCCTCATCTTTTGAAGACCCTGGTCAAGCATATGGTATAGGAATGACTTTGCATAGTTCTGGAAATTCTTCATCCCAAGTACCCTTAAAAGAAAATGATGTACTACATAAAAGATGGAGCATAGTATCTTCGCCAGAACGTGAGATCACCTTGGTGAACCTGAAAAAAGACGCAAAGTATGGTTTAGGATTTCAAATTATTGGTGGGGAGAAGATGGGAAGACTGGATCTAGGTGTATTCATTAGTTCAATTACCCCTGGAGGACCAGCTGATTTGCATGGATGCTTAAAGCCAGGAGACCGTTTGATATCTGTAAATAGTGTGAGTTTAGAGGGGGTCAGCCACCATGCTGCAATTGAAATTTTGCAAAATGCACCAGAAGATGTGACACTTGTTATCTCTCAGCCAAGAGAAAAGACATCCAAAGTGTCTCCTACTCCTGTGCACATTGCCAATGGCATGAAAAATTACATGAAGAAAGCTTCCTATATGCAAGACGGTGCAATAGATTCTTCTGAGGATCACCACCACTGGCCACATGGTACCCCGAGGCATATCTCAGAGAGCTCTTTTGGACTGTCTGGAGGCCTGCGGGAAGGAAGCCTGAGTTCTCAAGATTCCAGGACTGAGAGTGCCAGCTTGTCCCAGAGCCAGGTCAATGGTTTCTTTGCCAGCCATGTAGGTGATCGAACCTGGCAGGAATCACAGCACGGCAGCCCTTCCCTATCTGTGATATCCAAAGCCACCGAGAAAAAGAGGACTTCTAGTGACAGTAACCAAAACAAAGCTAAAAAAACAGGCATTTCTGATACAACAGATTATTCTGACCGCGGAGATTCAGACATGGATGAAGCCACTTATTCCAGCAGTCAGGATCATCATCAAACACCAAAAAAGGGAGGTGTGAATACGAGTGTCAGACATGGTGGCATTTACGTGAAAGCTGTTATTCCCAAGGGAGCAGCAGAATTCGATGGTAGAATTCACAAAGGTGATCGTGTCCTAGCTGTCAATGGAGTTAGTCTGGAAGGAGCTACCCATAAACAAGCTGTGGAAACACTGAGAAATACGGGACAGTTGGTTCATCTGCTGTTAGAAAAGGGACAGTCTCCAGCATCCAAAGAACATGTCCCTGTAATGCCACAGTGTGCCCTTCTGGATCTGAATGCCCAAGGTGAAGAAGGCCCAGAAAAAATGATGAAGAAAATGACATATGTCAAAGACTACAACTTTGTCACTGAAGAAAATACATTTGAGGTAAAATTGTTTAAAAATAGCTCAGGCCTAGGATTCAGTTTTTCTCGAGAAGATAATCTTATACCCGAGCAAATGAATGCCAGCATAGTAAGGGTTAAAAAGCTCTTTCCTGGACAGCCAGCAGCAGAAAGTGGAAAAATTGATGTGGGAGATGTTATCTTGAAAGTGAATGGAGCCTCTTTGAAAGGACTCTCTCAGCAGGAAGTTGTATCCACTCTCAGGGGAACATCTCCAGAAGTATCCTTGCTTCTCTGCAGACCTCCACCTGGTGTGCTCCCAGAAATCGACCCTGCTCTTTTGACCCCACTGCATTCTCCAGCACAAGTACTTCCAAACAGCAGTAAAGACCCTTCTCAACCAGCGTGTGTGGAGCAAGGCACCAGCTCAGATGAAAATGAAATGTCTGACAAAAGCAAGAAACAATGCACCTCCCCATTCAGGAGAGACAGTTATAGCGGCAGCAGTGGGAGTGGAGAAGAAGACTTAGTGAAAGCTCCAGCAAAGATAACAAATACAAGCTGGAGTTCAGCTTTGCATCAGTCTCTAAGCAACATGGTATCACAGGCACAAAATCAGCATGAGGCAACCAAGAGTCAAGATGATACCGTTTGCACCATGTTTTACTATCCTCAGAAAATACCTAATAAACTAGGACTCGAGGACAGTAATCCTTCTTCCCCTCTACCACCGGATGTGACTCCTAGGCAACCCCAAACAGAATCCACTTCCACTAATTCAGTGGATAAATATCATACACATCATATTTCTGAACCAACTAGACAAGAAAGCTTGACATCTTTGAAAAATGACTTGGAAAACCACCTCGAAGACTTTGAAATGGAAGTAGAACTCATCATTACCCTAATTAAATCAGAAAAAGGAAGCCTGGGTTTTACAGTAACCAAAGGCAATCAGAGTATTGGTTGTTATGTTCATGATGTCATTCAAGATCCAGCCAAAAGTGATGGAAGGCTAAAACCTGGGGACCGCCTCATAAAGGTTAATGATACAGATGTTACAAACATGACTCACACAGATGCAGTGAACCTGCTCCGAGCTGCACCCAAGACAGTCAGATTAGTCCTTGGACGAGTTCTAGAATTACCCAGGAAGCCAGTGCTGCCTCATTTGCTACCTGACATTACATTAACATGCAACAAGGAGTTGGGTTTTTCCTTGTCTGGAGGTCACGACAGCCTTCATCAAGTAGTGTATATTAGTGGTATCAATCCGAGGTCAGTTGCAGCCATTGAGGGTAATCTCCAGCTGTTAGACATCATCCACTATGTGAATGGAGTCAGCACACAAGGCATGACCTTGGAAGAAGCGAAGAGAGCACTAGACATGTCACTCCCATCAGTGGTGCTGAAAGCAACAAGAGATGGTCATCCAGTGGTCCCTAGTTCCAAGAGTTCTGCTGTTTCAACTCCAGAATCAACTAAAGCTAATGGTCATCACAATGTGGATCCTTGTGGCAAGCCTGCCCTCACTCCTAATAATTCCTTCTCCAAGGCTAATGGGGAAGAAATAATTGAAGTTTTGTACCCTGAAGGAAAATGCTCTACTCATCAAATGAAGGGATCAGCAAATTTGATTCTGTCCAAAGAATCTGATGTACAAGAAGATGATATTTATGATGATCCTCAAGAAGCCGAAGTTATCCAGTCTCTGCTGGATGTTGTGGATGAGGAAGCCCAGAATCTTTTAAACAAAAATAATGCAGCAGGAGATGCCTGTGTTCCAGGTGCACTGAAAACCAATGGGAAGTTATCTGAAGAGAGAGCAGAAGATACAGACTGTGATGGATCACCTTTACCTGAAGATTATACAGAGTCTACCAAAATGAATGGCTGTGAAGAATATTGTGAAGAAAAAGTAAAAAGAGAAAGCTTAACTCAAAAGTCACAAGAAAGGAAGACTGATGATTATGAAATAACATGGGGAAGTGACGAATTGCCAACAGAGACAACAAACCACGAAGATTCCATTAAAGATCATCCCCTTCTGACACATGAGGAGCTTGCTGCACTCCCCATCGTCAAAGTGCTTCCCTCTGGTAAATACACTGGTACCAAGTTGAAATCAGTCATTCGAATGATGCGGGGTTTACTGGATCAAGGAATTCCTTCTAAGGAGTTGGAGAATCTTCAAGATTTAAAACCTTTGGATCAGTGCCTAATTGGACAAACTAAGGAAAATAGAAGGAAAAACCGATATAAAAATATACTTCCCTACGATGCCACAAGAGTGCCTCTTGGAGATGAAGGTGGATATATCAATGCCAGCTTCATTAAGATACCAGTGGGGAAAGAAGAATTCATTTACATTGCCTGCCAAGGACCTCTCCCTACAACTGTTGGAGATTTCTGGCAGATGATTTGGGAACAAAAATCCACAGTGATAGCAATGATGACCCAAGAAGTAGAAGGGGAAAAAATAAAATGCCAGCGCTATTGGCCTAACATCCTAGGCAAAACGACAATGGTCAGCAACAGGCTTCGGCTGGCTCTCGTGAGAATGCAACAGCTAAAGGGCTTCGTAGTAAGGGCAATGACCCTAGAAGATATTCAAACAGGAGAGGTGCGACATATTTCTCATCTGAATTTCACTGCTTGGCCAGACCACGACACACCTTCTCAACCAGATGACTTGCTTACTTTTATCTCTTACATGAGACACATTCACAGATCGGGCCCAATTATCACACACTGCAGCGCTGGCATCGGACGTTCAGGGACCCTGATATGCATAGATGTGGTTCTAGGATTAATCGGTCAAGATCTTGAATTCGACATCTCTGATTTAGTTCGCTGCATGAGACTACAAAGACATGGAATGGTCCAGACGGAGGATCAATATATTTTCTGCTACCAAGTCATCCTTTATGTCCTGACACGTCTTCAAGCTGAAGAAGAGCGGAAAGAGCAGCCACAGCCTCTGAAATGACCTGAAAAGAACAGCCTTCTGGATGCCTTTCCCACTCTCTTCATAACCTCCAATAGTTGCTCCTGCTCTCCATTATAAAATAAGGATCCCAAGGCCATAAGTCCATACAATGTCTATACTTATTCTCCTCTACCTTAGAGGGGCATTCTTCATAACAACAAATAATGTTGAAATGCTGTATTTTTACAGCTGCTTTAACCTGTGACAATTGTTTTAAAATTTTTAACACAAAATAATGCAGATCTTAGGCACAAGTAAGGCAGCATTTGATTATAGTGGACATTGTTATAAGGATGCACTGAGTTTATTTTAAATGTACCAATCTTGTTTATAGCAAAATTCTTTTTCAGTATTTTAATAGTTATTTTATAGGGGATACAGTATTTAAGCTTTAAATGACAGTAGTTTGGGCATAGAAAAAAAGTAGCAAAGGTTTACTGTATCAATTTCTGATGTTTACTATATAGAATTTCCTGTAATATATTTATATACTTTTTCATGAAAATGGAGTGATCAGATATGTTTGTAACGGCATCATCTATGTTTGATATGCATCATCTCACTTTGTAAATAAAAAAACACCTTAAAACATGAACAAACCAAAAGTGTATGCAGACAAACTAAA