Transcript asmbl_41712

Sequence
Transcript Sequence for observation asmbl_41712 of TGE0003610:
GGAGCGACTGGAAGTGGGCGGAGTTTGAATTCCCTAACCCAGAGGAGGCGAGGTCGACAGGGCAAAGGACTCAGGTGCAGGCTTCCCTAACGGACTAGTTTTATTTGTACAGTCTCGCACCTAAAGAAGAAAGAAAATGGCCTGTGCCGAGTATTCTTTTCATGTGCCGAGTCTAGAGGAGCTTGCTGGAGTTCTACAGAAGGGACTAAAGGATAACTTTGCTGACGTCCAGGTTTCTGTAGTTGATTGCCCTGATTTGACTAAAGAGCCATTTACCTTTCCTGTGAAAGGCATCTGTGGGAAAACTAGAATTGCAGAAGTAGGAGGTGTGCCTTACTTATTGCCTCTTGTAAATAGAAACAAAGTCTATGATCTAAATAAGATTGCAAAAGAAATCAAGCTTCCTGGAGCTTTTATTCTTGGAGCGGGGGCAGGCCCATTTCAGACTCTCGGGTTCAATGCTGAGTTTATGCCAATTGTTCAAACAGAAAGTGAACACAAACCTCCTGTGAATGGAAGTTACTTTGCCCGTGTTAACCCTGCAGATGGAGGATGCTTACTAGAGAAATACAGTGAGAAATATCGTGATTTTGGGTGTGCATTACTGGCTAATCTTTTTGCCAGTGAGGGCCAACATGGAAAGGTCATTGAGGTGAAAGCCAAAAGAAGAACTGGAAAACTTAACTTTGTGACTTGTATGAGACAGACTCTTGAAAAACATTATGGAGATAAGGCTGTAGGGATGGGAGGTACTTTCGTAATTCAGAAGGGAAAAGTGAAGACTCACATTATGCCTGCAGAATTTCCTTCCTGCCCTTTGAACTCTGAGGAAAAGGTGAATGAATGGTTGAATTTTTATGAGATGAAGGCTCCTTTGATTTGTCTGCCAGTTTTTGTCTCCAAAGACCCAGGATTTGATTTGCGATTGGAGCACACTCACTTTTTCAGTCATCATGGAGAAGGTGGACACTACCATTATGACATTACCCCAGATATAGTAGAATATCTTGGCTACTTCTTACCTGCGGAGTTTCTTTATCGCATTGATCAACCAGAAGAGACCCATTCATATGGGCGAGATTAAATCAACTGATCAGCATTTAGAAAAAGAAGTGATTAACTAAAGTTAATTAAATGATTAACTCATTAATTGCTACAAATATAAAGTTCAATAGAAATGATCTTACTACTTAAACCCTATTTTTTTGGCCTTTGAAATGAAAGGTATGTTGACATTACTCTGTTATTTCATAGATCTGAAAAAGTTTCTTGGGAACAAAGATATATAATGGAGATGTTCTTCATTATTTTTTTATTCTAAAAATCAGTCTTATATTTATACCTTAAATATAAACATGATCTGGAATCATGTGATTGGTTAATTTTACTAACAGTAATAATTTACACTTAACATTATTAATTTTTTCAAATTAGTCTCACAACTGCTAATTGGGTATTTCTGGGTACTAGAAAAATCAGTGTTGGAAATTTTGATAGTTGTTGAATCTTTGTATTGAATTTTAAAAGTCTATTTTAGGAGTCAGAGTACACTTTTTTCATGGAATAAGGTGATCAGAAGGAGCAACTTTACCCCTTTTGGTGAAGTTGAACCATACTCAGAGTTTGCAGTTTGCCTTGTACAAACATTAGCAACTAGACAGTTAGCCATGATTCCTCTTTTGTTTGGATCGCCAACTGGAAGCAGTTTGTACCTTATTAGTTATTTGGAAGAAGAAAGCGGGGAAAAGAAACAGCATCAAAATACAACACTGAAGTGAGTATAATTTCTAAGTGAGGCTGTTGTTACACATGACCACTGTCCTTTGTGAAATATAAAATTATATTTGAATACATTTGTTACTGGTTATAATGGTTGAAATTTTCTTCAGTGTTCTTCTGTAATAATCATTAGTAAGAAATCAACTGTAATCTTATTAATGCCAACAATGTGCAGATTTAGGAGCTCTTCAGTACTAAGCACATAATAAATCAAAAAATATTATTTGATTGTCTTCTCTGGATGTAAGCTATAACATATCCTTTGAGTATAAATTTTAAAATATTTTTAAATAAGTACTAGTTTGTAGCAAAAGAATGAATAAAATTTTAAAATTCACAATATGATATTGTTTCTTTTTAATATTTACCTCTAGACAAAAATAATATTAATATTCACGTAAATATGTATTGAACACATACCCTGCTCTCTGGAATGTATGCTCTATGAAGACAAGAGCTTTGATCACCAGTATAGCACTAGTGCCTTCAACAGTGTCTGGCCAAAGTAGGCACTCAATAAATATTGGTTGAATGAATGAATGGGTGGATGATTATACCAGATACTTGACTAGATGCTGGGATCTATCATTCAATCATTTATATAGTAGGGAAGACAAATATTAAGCAAATATATAATAATGTCAGGTGGTAGTAAGTGCTATGAAGAAAATAAAGCATTGGATGAACTGTAAAGGTAGATGCTATTTTGTTGTGGCCATCCTATGCCGAGACAGAATGGACTCCCCACGCAAAATTTGGTTCAAATGTCAAGACTGATGAAGTCCTTGGGGGTTTGCTGGTGGTTAGGAGGTACGGCCAGGGTGACGGTTCTGCATGCAGTTTGATTTTCCCACAAGTGTCGAAGGAAGGAGCACCCAGGCTTTTTTGTCAGCTTGCCCAGATGTGGGGCAGAAAGGGAAGAAAGGGTAAGGCTTAGCTGTCAGCAGTCAAACATCAAAAATGGAATCAGACTCTCTATATAAGGACATTTTATATAGGGAGATCAGGGAAAGCTTCTGATAAAGAGATACGTGAGCAAAGACCTGAAAGAAATAAGAAGTGAGACATTAAGTTCTTTGTAAAAACATCCTTCCTGGCAGTTTCAAAAGCCCAGAGGCAGAAGAGAACTTGGTATGTTCAAGAAACAGCAAGGAGGCCACTGTGAACACAACAGGATTCTCTGAGAAGCAATTTTTAAAATTATATATATAGATATATCTATTCACAAAATTATGTTAATGCCATATACACTTTGAAATTAGAAATGTGAGGATGCCCAATATCATTAATTATTGGAATTTCAACCAAAAAAAAAAGGACAGGAAAGAGAAGAACCGTAACTACCAAAAAGGAAGAAAAAAATAAGCTTTTTAGCAGAAAACATGATTCACTTCTTAGAAAACAAAAGAGAATGTATAGTGAAATTATTAGACTGAGTTCAAAAAGTTTCTAAATATAAAATCAATATATAATGGATTGTATTTCTGCAAACTAACAAGAAACAATTAAAAATGTAAATGTGAAAAAGATCAATTACAATGTTATCAAAACTACATAGCAATACTTTAACAAAAATTACATATAACCTTCATTGATAAAATTATAAACCTGTTGTAAACTTAAAGAAGTGTCAAAAAATAGTTATAACTAGGAAGATGCAATCTCATTAAAATATCAATTCTTCTCAAAACTATACATTCAGTTCAATACGCACCTAATCCCACTAAAGCTTTTCATAGAACCTCAGCAGTTGATTCTAAAATATATGCATTAGCAAAAGGCCAAGATAAGCAAAGACAATTTTCAAGACGACTAGGTTAGGGATATTTGATATATAGATATCAAAATCTATAAACTTATTAAAAGATCATGTTTTTGGCACAGTGATGGACAATCAAACCAATAGAACAGAAAACCAAGACCAGAAACAGATCCTCACATATGTAGATACTTCAATGAGGAAAGGAAAATGTATTCAAATAGTGCTGCCACAACCAGTTTTTAATATAGAAAAATAAAATTAGATTGGACTCAATACTCAATGAATTAAAGACTTAAATGTGAATATTAAATTGTTTAAAGTTTTAAAAAAGTGTAAGAGGTTATCTTTATGACATTGGAGCATAGAAGGATTTCTTAAAGAACATAAGACAAACTATTAAAGACAGATAAATCTGATCTGACAACATCAAAACGTAAAACTTTTCTTGGTCAAATTATATCTCAAAAAGGAAGAAAGCAGACCACGGTCTGGGAGAACATATTTTCAAAACATAGCTGATGAAATTCAGCTCGTATTCAGAATGCATTAAGAAAATCTCCAAATCAATAAGGAAAAGACAAACACCCAATAGAAAAATAGAAATTATGAACTGGCATTTAGCAGAAAAGGAAAAACCAATGGCCAGTGTTAAATGTTAAGATTTCTATTTCCAGTAATAGTGGATTAGATAATTCAGACAGATCCTCACTAAAGATAATTTTAAAAGCTGGAAAAATATAAATGTACCTCCTTGAAGGTACTAATAAAGAGTTAACAAGATAGTGAAAGACTACTTGGCCAATGAGTATCTAGGAGAGAATGGAAGCCCAGCTTAGGTCCACCAATCCCCAGAAAACAGATGCTTAAAGTATGAATGATTACTGTTTTAAACCTGTGACCTGGAGTGCTCTATTTCACAGAAATTAAGTGACTGATTTAAAAATAAACACATGGAAATAAGTCATGGTATTGCTAGGAGGAGAGAGGGAGATGTGAACTAGGAGTACAAAGGAGCTTTAATTGTATCAGTAATATTTCCTAATAAAATGGTGTCATTACACAGATAGTTATTGGTAACTTCTTTTTAACTCTTAAATATAAAGTTAAGGACATAGTACCATGAATCTCTTTCTTGGAAGTATGTTCTTTTGTACTTAACTTTTCATGTATTTTCTTAAAATATCTTTGTTTGTACTAAAGAATTATGGTGATTTAGTAATGTACAATTATTTTTAAGTTAACTATTTCTCTTTTGTTCTCTT