Transcript asmbl_41711

Sequence
Transcript Sequence for observation asmbl_41711 of TGE0003610:
GGAGCGACTGGAAGTGGGCGGAGTTTGAATTCCCTAACCCAGAGGAGGCGAGGTCGACAGGGCAAAGGACTCAGGTGCAGGCTTCCCTAACGGACTAGTCTCGCACCTAAAGAAGAAAGAAAATGGCCTGTGCCGAGTATTCTTTTCATGTGCCGAGTCTAGAGGAGCTTGCTGGAGTTCTACAGAAGGGACTAAAGGATAACTTTGCTGACGTCCAGGTTTCTGTAGTTGATTGCCCTGATTTGACTAAAGAGCCATTTACCTTTCCTGTGAAAGGCATCTGTGGGAAAACTAGAATTGCAGAAGTAGGAGGTGTGCCTTACTTATTGCCTCTTGTAAATAGAAACAAAGTCTATGATCTAAATAAGATTGCAAAAGAAATCAAGCTTCCTGGAGCTTTTATTCTTGGAGCGGGGGCAGGCCCATTTCAGACTCTCGGGTTCAATGCTGAGTTTATGCCAATTGTTCAAACAGAAAGTGAACACAAACCTCCTGTGAATGGAAGTTACTTTGCCCGTGTTAACCCTGCAGATGGAGGATGCTTACTAGAGAAATACAGTGAGAAATATCGTGATTTTGGGTGTGCATTACTGGCTAATCTTTTTGCCAGTGAGGGCCAACATGGAAAGGTCATTGAGGTGAAAGCCAAAAGAAGAACTGGAAAACTTAACTTTGTGACTTGTATGAGACAGACTCTTGAAAAACATTATGGAGATAAGGCTGTAGGGATGGGAGGTACTTTCGTAATTCAGAAGGGAAAAGTGAAGACTCACATTATGCCTGCAGAATTTCCTTCCTGCCCTTTGAACTCTGAGGAAAAGGTGAATGAATGGTTGAATTTTTATGAGATGAAGGCTCCTTTGATTTGTCTGCCAGTTTTTGTCTCCAAAGACCCAGGATTTGATTTGCGATTGGAGCACACTCACTTTTTCAGTCATCATGGAGAAGGTGGACACTACCATTATGACATTACCCCAGATATAGTAGAATATCTTGGCTACTTCTTACCTGCGGAGTTTCTTTATCGCATTGATCAACCAGAAGAGACCCATTCATATGGGCGAGATTAAATCAACTGATCAGCATTTAGAAAAAGAAGTGATTAACTAAAGTTAATTAAATGATTAACTCATTAATTGCTACAAATATAAAGTTCAATAGAAATGATCTTACTACTTAAACCCTATTTTTTTGGCCTTTGAAATGAAAGGTATGTTGACATTACTCTGTTATTTCATAGATCTGAAAAAGTTTCTTGGGAACAAAGATATATAATGGAGATGTTCTTCATTATTTTTTTATTCTAAAAATCAGTCTTATATTTATACCTTAAATATAAACATGATCTGGAATCATGTGATTGGTTAATTTTACTAACAGTAATAATTTACACTTAACATTATTAATTTTTTCAAATTAGTCTCACAACTGCTAATTGGGTATTTCTGGGTACTAGAAAAATCAGTGTTGGAAATTTTGATAGTTGTTGAATCTTTGTATTGAATTTTAAAAGTCTATTTTAGGAGTCAGAGTACACTTTTTTCATGGAATAAGGTGATCAGAAGGAGCAACTTTACCCCTTTTGGTGAAGTTGAACCATACTCAGAGTTTGCAGTTTGCCTTGTACAAACATTAGCAACTAGACAGTTAGCCATGATTCCTCTTTTGTTTGGATCGCCAACTGGAAGCAGTTTGTACCTTATTAGTTATTTGGAAGAAGAAAGCGGGGAAAAGAAACAGCATCAAAATACAACACTGAAGTGAGTATAATTTCTAAGTGAGGCTGTTGTTACACATGACCACTGTCCTTTGTGAAATATAAAATTATATTTGAATACATTTGTTACTGGTTATAATGGTTGAAATTTTCTTCAGTGTTCTTCTGTAATAATCATTAGTAAGAAATCAACTGTAATCTTATTAATGCCAACAATGTGCAGATTTAGGAGCTCTTCAGTACTAAGCACATAATAAATCAAAAAATATTATTTGATTGTCTTCTCTGGATGTAAGCTATAACATATCCTTTGAGTATAAATTTTAAAATATTTTTAAATAAGTACTAGTTTGTAGCAAAAGAATGAATAAAATTTTAAAATTCACAATATGATATTGTTTCTTTTTAATATTTACCTCTAGACAAAAATAATATTAATATTCACGTAAATATGTATTGAACACATACCCTGCTCTCTGGAATGTATGCTCTATGAAGACAAGAGCTTTGATCACCAGTATAGCACTAGTGCCTTCAACAGTGTCTGGCCAAAGTAGGCACTCAATAAATATTGGTTGAATGAATGAATGGGTGGATGATTATACCAGATACTTGACTAGATGCTGGGATCTATCATTCAATCATTTATATAGTAGGGAAGACAAATATTAAGCAAATATATAATAATGTCAGGTGGTAGTAAGTGCTATGAAGAAAATAAAGCATTGGATGAACTGTAAAGGTAGATGCTATTTTGTTGTGGCCATCCTATGCCGAGACAGAATGGACTCCCCACGCAAAATTTGGTTCAAATGTCAAGACTGATGAAGTCCTTGGGGGTTTGCTGGTGGTTAGGAGGTACGGCCAGGGTGACGGTTCTGCATGCAGTTTGATTTTCCCACAAGTGTCGAAGGAAGGAGCACCCAGGCTTTTTTGTCAGCTTGCCCAGATGTGGGGCAGAAAGGGAAGAAAGGGTAAGGCTTAGCTGTCAGCAGTCAAACATCAAAAATGGAATCAGACTCTCTATATAAGGACATTTTATATAGGGAGATCAGGGAAAGCTTCTGATAAAGAGATACGTGAGCAAAGACCTGAAAGAAATAAGAAGTGAGACATTAAGTTCTTTGTAAAAACATCCTTCCTGGCAGTTTCAAAAGCCCAGAGGCAGAAGAGAACTTGGTATGTTCAAGAAACAGCAAGGAGGCCACTGTGAACACAACAGGATTCTCTGAGAAGCAATTTTTAAAATTATATATATAGATATATCTATTCACAAAATTATGTTAATGCCATATACACTTTGAAATTAGAAATGTGAGGATGCCCAATATCATTAATTATTGGAATTTCAACCAAAAAAAAAAGGACAGGAAAGAGAAGAACCGTAACTACCAAAAAGGAAGAAAAAAATAAGCTTTTTAGCAGAAAACATGATTCACTTCTTAGAAAACAAAAGAGAATGTATAGTGAAATTATTAGACTGAGTTCAAAAAGTTTCTAAATATAAAATCAATATATAATGGATTGTATTTCTGCAAACTAACAAGAAACAATTAAAAATGTAAATGTGAAAAAGATCAATTACAATGTTATCAAAACTACATAGCAATACTTTAACAAAAATTACATATAACCTTCATTGATAAAATTATAAACCTGTTGTAAACTTAAAGAAGTGTCAAAAAATAGTTATAACTAGGAAGATGCAATCTCATTAAAATATCAATTCTTCTCAAAACTATACATTCAGTTCAATACGCACCTAATCCCACTAAAGCTTTTCATAGAACCTCAGCAGTTGATTCTAAAATATATGCATTAGCAAAAGGCCAAGATAAGCAAAGACAATTTTCAAGACGACTAGGTTAGGGATATTTGATATATAGATATCAAAATCTATAAACTTATTAAAAGATCATGTTTTTGGCACAGTGATGGACAATCAAACCAATAGAACAGAAAACCAAGACCAGAAACAGATCCTCACATATGTAGATACTTCAATGAGGAAAGGAAAATGTATTCAAATAGTGCTGCCACAACCAGTTTTTAATATAGAAAAATAAAATTAGATTGGACTCAATACTCAATGAATTAAAGACTTAAATGTGAATATTAAATTGTTTAAAGTTTTAAAAAAGTGTAAGAGGTTATCTTTATGACATTGGAGCATAGAAGGATTTCTTAAAGAACATAAGACAAACTATTAAAGACAGATAAATCTGATCTGACAACATCAAAACGTAAAACTTTTCTTGGTCAAATTATATCTCAAAAAGGAAGAAAGCAGACCACGGTCTGGGAGAACATATTTTCAAAACATAGCTGATGAAATTCAGCTCGTATTCAGAATGCATTAAGAAAATCTCCAAATCAATAAGGAAAAGACAAACACCCAATAGAAAAATAGAAATTATGAACTGGCATTTAGCAGAAAAGGAAAAACCAATGGCCAGTGTTAAATGTTAAGATTTCTATTTCCAGTAATAGTGGATTAGATAATTCAGACAGATCCTCACTAAAGATAATTTTAAAAGCTGGAAAAATATAAATGTACCTCCTTGAAGGTACTAATAAAGAGTTAACAAGATAGTGAAAGACTACTTGGCCAATGAGTATCTAGGAGAGAATGGAAGCCCAGCTTAGGTCCACCAATCCCCAGAAAACAGATGCTTAAAGTATGAATGATTACTGTTTTAAACCTGTGACCTGGAGTGCTCTATTTCACAGAAATTAAGTGACTGATTTAAAAATAAACACATGGAAATAAGTCATGGTATTGCTAGGAGGAGAGAGGGAGATGTGAACTAGGAGTACAAAGGAGCTTTAATTGTATCAGTAATATTTCCTAATAAAATGGTGTCATTACACAGATAGTTATTGGTAACTTCTTTTTAACTCTTAAATATAAAGTTAAGGACATAGTACCATGAATCTCTTTCTTGGAAGTATGTTCTTTTGTACTTAACTTTTCATGTATTTTCTTAAAATATCTTTGTTTGTACTAAAGAATTATGGTGATTTAGTAATGTACAATTATTTTTAAGTTAACTATTTCTCTTTTGTTCTCTT