Transcript asmbl_41571

Sequence
Transcript Sequence for observation asmbl_41571 of TGE0003598:
CTTTCTTGGCCTCAGTTTCCTCATCTATGGAATGGGGTTGAGAGGAATATCTACCTCACAGTGTTGTGGGGAGTTACTCAGATAATGGGTGTGTGAACATGCTTTTGAACTGTAAAGGACTGTTTCATTGTGAGATGTTATCATTCTTCTCTTTTTTCCTTCCCAGAGACCCCCCCGGCCGCCCTCCTTCCCTTGTTCCTGTGGCTGGGGGGGGTACCCCCTCCCTCCACACCATGGAGCCATCTCCTCTGTCTCCAAGTGGGGCAGCAGTCTCCCTGCCTCTGTCGCTGGCCCCGCCCCCACTGCCCCTGCCTGCAGCTGCAGTGGTACACGTGTCCTTCCCTGAAGTAACCAGTGCCCTCTTGGAGTCCCTCAATCAGCAGCGGCTACAGGGCCAGCTCTGTGATGTGTCCATCCGAGTGCAGGGCCGGGAGTTCAGGGCTCATCGCGCTGTCCTGGCTGCCTCCTCCCCATACTTCCACGACCAAGTCCTGCTCAAGGGCATGACTTCCATCTCGCTGCCCAGCGTCATGGACCCAGGAGCCTTTGAGACTGTCCTGGCTTCAGCTTACACTGGCCGCCTCAGCATGGCTGCTGCTGATATTGTCAACTTCCTCACAGTGGGTTCTGTGCTCCAAATGTGGCACATTGTGGATAAATGCACTGAACTCCTTCGTGAAGGCCGGGCCTCGGCCACCACTACCACCATCACCACTGCTGCAGCCACCTCAGTCACTGTCCCTGGTGCTGGGGTCCCATCAGGAAGTGGGAGCACTGTGGCCCCTTCCACCATGGGCTCTGTGCGCTCCCATGCCTCCAGTCGGGCCAGTGAGAATCAGTCACCCAGCAGCAGCAACTACTTCAGCCCCCGAGAGTCCACTGACTTCTCATCTTCCTCCCAAGAGGCATTTGCAGCTTCTGCAGTGGGCAATGGGGAGCGTCGAGGAGGTGGCCCTATATTCCCAGCCCCTGTGGTTGGCAATGAGGGGGCTACCTCTGGGAAGCTGCTGCTGGAAGCAGATGAGCTGTGCGATGATGGTGGGGATGGGAGGAGTGCAGTGGTTCCTGGGGCTGGGCTCCGGCGTTCCACCTATGCACCCCCCAGCATCATGCCACAGAAACACTGGGTATATGTGAAGCGGGGTGGAAACTGCCCAGCACCAGCGCCCCTGGGTTCCCAAGACCAAGATCTGGAAGAGGATGAGGAGGAGGAAGACCTGGTGTTAACCTGTGAAGATGATGAAGATGAGGAGCTAGGGGGTGGCTCCCGGGTTCCAGCAGGGGGAGGAGCTGAGGCTACCCTTAGCATAAGTGATGTCCGGACCCTGACTGAGCCTCCCAGCAAGGGAGAGGAGCAGGTCAATTTCTGTGAGTCCTCCAATGACTTTGGCCCCTATGAGAGTGGGGGTCCTGGAACAGGGCTTGATGATTCCGGGGGGCCCACCCCTTCCACCTATGCCCCCTCCCACCCACCACGGCCCCTGCTTCCTGTGGATATGCAGGGCAACCAGATCCTAGTCTTCCCATCATCTTCGTCCTCGCAGGCTCCAGGCCAGCCACCAGGGAATCAAGCCGAACATGGGGCAGTGACCCTGGGGGGCATATCCACAGGGGGCCTGGGCATGCAGGGTGGTGCTGTTGGGACCCCTGGAGGGACAGGCAGTGGGGATGGGAATAAGATCTTTCTGTGCCACTGCGGGAAGGCCTTCTCTCACAAGAGCATGAGAGATCGTCATGTGAACATGCACCTCAACCTGCGGCCCTTTGACTGCCCCGTGTGCAACAAAAAGTTCAAGATGAAGCACCATCTGACTGAGCACATGAAGACGCACACAGGCCTCAAGCCCTACGAATGCAGCGTCTGCGCCAAGAAGTTCATGTGGAGAGATAGCTTCATGCGCCACCGAGGACACTGTGAGCGCAGGCACCGCCTGGGCGGGGGCGGGGCCGGACCAGGGCCTGGGGGGCCCACTGGGCCAGCCTTGCCACCCAAGAGAGAGTCCCCCGGGATGGGCGGGGGCAAAGGCGACGAGGCGGGTGGGGCCACGCCGCCGTCCAGCCGTCGGGTCTGGTCCCCACCCAGCCTCCACAAAGCGGAGATGGGCTTTAGTGGGGGCGGAGGAGCAAACTGAATGGGGCAGGCTACTGGGGGTAGCTTTCAGGGAAGAAGAAAGGGAGTACGAGCCAGAAGCGCTGTGGCCCCCAGGTAATCTCTCACCACGGCTGTTTTCCTTATCTCTCTGCACTTGTATATATTCTGGAGGGCGAACCATATTGTGCCACCGACCACCCCATTCCACTCCTCAGCTCCTCCCCTCAAAGTATCCCTGGAACTAAGCCCTTCCTTTCCCTCAAATGGGTACCCTAAAGCCCCAGCTCCAGAGTAGGGTGCATATGGTGGGGGGAGGGAGAGGGTACCTGTTAAGCATCCTGGAGTCACAGGATCAAGGATCAGGTGGTCGTAGTCTGTACCTGAAGTCTGTGTTTGTGTTGTTGTAGGGACCAGGCCTTTGAGCCCCACCCTTGTCCTAGAACCCACCCCACTCCTCCCTCCCCAGGATGTGCCCCTTATTTCTACCCCAATCTCTCCCCCACCTTGGGGTCCCTCAACTCTATTCTCTTTAGGGAGTAAGTCGTAGGAGTACAAGGTTTTTATTTTAAATCATATTTTTTTTAAACGGTAATTAAAATATTTATTGGTCATTGCACTTGGCTTGCCGACAACCCCTATGTGTTTGCTGGGGACCTGGCACAGGTGGGGGAAGGAGGAGTAATGGTTCTCTATGAAGTGGATTCTAGAAGGAGAAGACGGGAGAGCTGGGGAAGACTGTGGGACTCGGCGGTGTTGGGTAGTTCCGGTAGGGCGGGGCGCGGCCGAGGTCCCCAGACCAGAACTGGAGAGGATATTCGGGATCCCTACTCCGCTAGTGGAGAAAGGACCTGCCTCCCACGCACCCTCACCTAACCAGAGCGGGGATTTCTATGGCCCCTCCTGCTGGCTTTTTGAAGAAAGCGAAAGTGAAAGAGGGAAGAAGACTGAGGAGATCGCGGCGCCATGAAGCACCTGTCCCTGCTCCTCGCTCTGGCTTTGGGCTTGGTGACCGCCGTCTCGGCGGGACCCACGGTGATAGAATGCTGGTTCGTGGAGGATGCAGACGGGGGCCGCCTGGCCAAGAAACCCGCTGCATTGCTGCTGCGCCAGGGCCCAGGGAGAATACCTCCCCGGCCGGACCTCGACCCCAAGCGCTACCTCAGAGTACATGACCCCACAGGCACCCTGCAGGCTGCCTTCAGGCGGTACCCCCGGAGCGCCCCCACGCCACACTGCGAGATGAGCCATTACATCCCACTCCCCGCCTCTGTGAATTGGGTCAAAGGCCTGACTCCGGAGCAGAGCTGCCCGCGGGCCTTGGACGGGACTTGGTTCATGGTCAGCATGTCCAGCCCGGTCCTCAGCCTCTCCAGCCTCCTACAATCACAGACCGAGCCTCAGCCAGATCCTGGACTCATCACCATGGCAACAGCTGTGCTGACTGTCATCACCCACAACCCCACCACTAGAATCCAGCTGGGACAAGATGCTCTGCTGGACTTGAGCTTTGCTTACATGCCCTCCACCCCAGAGGCCACTACACCTCTGGCCCCAGGTCCCCCTCCCTTTGGGCTGGAGTGGCGACACCAGCACCTAGGGGAGGGGCACCTGCTCCTGGCTGCAACTCCTGGGCTGCGTGGGCAAATGCCAGCTGCCCGAGATGGGGCAGTGGCATTTGCCGCTTGGGATGATGATGAGTCATGGGGTCCATGGACTGGAAATGGGACCCTCTGGCTGCCTGCAGTGAAGCCTTCCCAGGAGGGTGCCTATCAGGCCACCATATACCTGCCATATCTGCAAGGACAGGTCACCCTGGAGCTTGCTGTGCAGAAATCCCCCAAAGTGTCCCTGATGCCATCACCTCTTGTATGGGCTGCCCCTGGGGAGGCACCCCCTGAGCTAGTTTGCCTTGTGTCCCACTTCTACCCCTCTGAGGGCCTGGAGGTGGAGTGGGAGCTCCGAGGTGGTCCAGAGGGGAGCTTTCAGAAGGCCAAGGGGCAGAGTTGGCTCTCAGCCCTGCACCACCACTTGGATGGCTCTGTCAGCCTCTCTGGGCACCTGCAGCCATCCCCGGTCACCACTGCACAGCACGGGGCGCGCTATGCCTGTCGTGTCCACCACCCCAGCCTACCCGCATTGGGGCGCAGTGCTGAAGTCACCCTGGAGGTGGCAGGTCTCTCTGGCCCCTCCCTGGAGGATGGTATAGGCCTCTTCCTGTCTGCTTTTCTGCTCTTGGGGCTCTTCAAGGTACTGGGCTGGGCAGCTGCCTACCTGTCCACTTCCAAGGAATCAAAGAAGAAAGCACAGTGAGGGCACTCAAGACCACCCTGGGGAAGCTACCATCATCTCTGACCTGAACTACTGTAGTAGCTCCTCCAAACAGTATGCCATCACCTGCTCCTGCTCCTGCTCCTTCCAATCTCTCTCCACGGTGGGAATGCTTTTTTAAAAAAGACACAAATCTATAGCATTCACCTTCTTAGAGCTCTAAGGCTGTGGTTCTCAAAATTTTTGGTCTCAGGACATCATAAAAACGAAGGACTCTCGAGCTTTTGTTTATGTGGGTTATAAACTAACTATTTATCATACTAGAACTTAAAACTGAGAAAAGTTTAAAACAGAAGGATACACAGGCACACATTCCATTGGCTGTGAAGGAGATAATGTCAATACACATCATGTAGCTCTGGGAAATTTCACTGTACATTTTTTTAGAGAATGAAAGTGAAAAAGGCAAATAACATTTTAGTGTTATGAAAATAGTCTTAACTTCGTATGCGCAGTGAATTAGTCTCAGAGATCTCTGGGGCAGGGACCACACCAAGAGAACGGGTGCTCTAGAGGCCAAATCCATTCTTCTTGCCCTTGGCACATGAATTTACGGCGCTGGAGCCACTGCTTACCTCTTCAACCCAATCTGGTGCTCTCCAGCACTCTCAATACTCATCACACCTACAGCTCTTCCTTTCCTCCAATGGCCTCTCACCTTCCCTAGGTCCCAGAGTTCTGTTCTCTCTGCCTGGTCCACCCTCGCTCTCCCTGGGCTCCAGACCAGATCAGCCAAGTCATTCCCCTCAGACCGCCGCGTGTCCCTCTTGTGCGGTTCACCACGGTTGTACTTAAGTGATTGTGCGAGTTGTTAAAGCCCGTTTCCCGGACTCTCAGCTCCTCGCAGTTGCAAAAACAAGTCTGTATGTCCACTGCTTTATCTCCCGCATCGGCAGTGGGCCTGGCGCCCACTGGAGGGCGCTCGGTATAAGAAGTTATAGTCCTTTTTTTCATCCTAAGGATTCAAAAACAGGTATAGGGTCAAGTAACTACTGGACGAAGGAAGCGGCGACTTAAGGACCTCCGAGGGGCAGGACCGTGGGCCAGACCGACGCGGGGAGCGAGTCTACTCGGTGGGAATAAAGTTGTGTTCCAGTGCTTCCAACGGCTGTCTCATTCTACCCCAGGGTCCCCTTTCCAAGCACACGACTCTACCAGTCACCTCTAGTCTTTTCCAATTACCCTGACCTCCTGGCGACACCCGATCCCCCTTCGAAACAGCTTGGTGTCAGGTGCCCCTAGCAGCAGGTTCTCCCGGGTGACCAGGGGAGCAGAAACAGAGTCATCCAGCGCCGGAAGCCCCAGAGCATCCACTCTGGAACCGGATGTAACGGCTTCCTGCTCCGCCCCTTGGCGGAGGTGGGGGGGCCCAAGGGCTCTCGGGAAAACCGGGAGTGGATTTAGGGCCGCTACACGCGTGGATGGGGTGTGTAACCCAGCGTGGTGGTGTAACTGGGCCCCTCCCCGCCCAAAACGCGTCCTGCAGGAGTTTTAGGCTTGTGTGGAGGGAAGGGAATGTGATATTCTGCTCTCGCTTTACCCCGAGGCTGGAGACTGGGATCTTTATCTCAATTCAGTGGGGGCGACGTGGGTTCCAGGATCCCCGAATCCGGGGGGTTGGAGGACAGTGGATCTCGGGACCCAAGCTCCTGGGTCCTGGCCCCTGGGCGTCCAGCACTCCCCCTAGTCCGCGGGCCTAACTCTTGTTCTCACTTCCTTCCCTTTTTGGCTCCTGTTCTCGAAGCAGGCGGACGTGGGGGGGCGGGG