Transcript asmbl_41414

Sequence
Transcript Sequence for observation asmbl_41414 of TGE0002448:
GGAAGCCACAGGAATAACGCATCTCTCGCGATAACAAGGTTCCTATTTGAGCGCATGCGCGAGCTGAGTTAACCTCTTTTCCGGTTTTTGTGGCGCGCGGCATCATGAGCAGCAAAGTCTCTCGCGACACCCTCTATGAGGCTGTGCGGGAAGTCCTGCACGGGAACCAGCGCAAGCGCCGGAAGTTTTTGGAGACGGTGGAGCTGCAGATCAGCTTGAAGAACTATGATCCTCAGAAGGACAAACGCTTCTCTGGCACCGTCAGGCTTAAGTCCACTCCCCGCCCAAAGTTCTCTGTATGTGTTCTGGGGGATCAGCAGCACTGCGATGAGGCCAAGGCTGTGGATATTCCCCACATGGATATCGAGGCATTGAAAAAACTCAACAAGAATAAGAAACTGGTCAAGAAGCTAGCCAAGAAGTATGATGCCTTTTTGGCTTCAGAGTCTCTGATCAAGCAGATCCCACGAATCCTGGGCCCAGGCCTGAATAAGGCAGGCAAGTTCCCTTCCTTGTTGACCCACAATGAGAACATGGTGGCCAAAGTCGATGAAGTGAAATCCACAATCAAGTTCCAGATGAAGAAGGTGCTATGTCTAGCAGTGGCCGTTGGCCACGTGAAGATGACAGATGATGAGCTTGTGTATAACATCCACTTAGCTGTCAATTTCTTGGTGTCATTGCTCAAAAAGAACTGGCAGAACGTCCGGGCTTTATACATCAAGAGCACCATGGGCAAGCCCCAGCGCCTGTACTAAGGCACAGCTTAATAAACCATACTGTTACCATTACCTGTCTGCCTGTGACCAAGGGGAGAGGGAGGTATTTTGACAGCTGTCATTGCATGCCACAGCACAGTGAAGGACAGTCATTTTACCCAAACTGCAAGGAAAGCCATTGTTATTGCCTTCAAAATTCTACAATCTTACTCCAATTTATTGGATATTTATGTTGTGATAGTCGGGCTGCTAACCTGGACTTGAAGCTTTTCTAATAACCTTGAGGGGGAGGGACAGATCAGGGCTAGGCTATGTGCTTCTGCTGCTTATGGAGTGGAAAGGATTAGGTGTTTCACCTTGAAGATATTGACTCAGCCTTTGGCAACATGCTTAATGTGTGACTTAACGTTAACCTCCTTGTATGTCAGAGATTGGTTCTTAATGTAGGCTTTTTGTGAGATTTTTGTGTTCTTTTTAATCCCTCTAAGCCATGCATTTGGGGTTGGTCTGTAGATCATAAAGTATTAAAAATGGAGTTTGGATACCTAGATGGTTATGATGGGAGTGGTCCACAAACTCTGAGAAATTGGTCTAGTATTTGCTTGCCTGACCCCAAGTTGAATACCATATATTAAGGGTAATTAGAAACTGCTTAAGATGTTTAGGAAAACATAAGACCTGTGCAATATTGTAATGGGCCCTGTTGATCTCTTCTAAGGAAGCAATGGGTGGCATTAGGCTGGAAACTCCCAGGCCCATTGTGCAATACCCCCAACTCCAGGCAGTCTCCCCTTCTCTGATCCTCAGAGAGAGTTCTTACCTCTGATGCTAGGCACTGGAAAAGTGGCTTTTGGTATAGTGGGAAATAATTAGCTCCATTTATCTTTGGTGAATAAAGGGATCAGTTCATCCCTCCAGTTTTGTTTAATATTGCTGCAAGGCTAATCCAAAGCATGGAAATGCTGTACGTTTTAAAAGAAGCATTACCTGTCCTTGAAGCATGAAAAGTACAAGGTTCTCACAAAAGACCTTAAGCCGTTTTTTTTTGGTGGTGGGGGGGTGTTGGCCTCTTTTACCTTTTTAACTGCAGGTAAAATAACTACAGTGTAATGTTGAGAGCACTGAATTTTGGTTTTTGAGGTAGGCCAGCTTGCTCCTTGAATTATTAGTGATAAGCTTGTTGAACAATGTTCCTTTAAGGAGGGACAAAAGCTGGCTATAAAATTAGGGCCTAATTTTATTGAAATGTTTATTCATAAAAACAATTGGAAGCTGACAAATTTGACCATGTTTAAGTGATTTTTAGGATTTTTTGAACTCCAATTTATGTAATCGGGAAAAAAGGCAATACTTGAGATACGGCAAGAAGATCTATGGCGATTTGATGAGGAATGTAGTACAAAAAGATTTATGAGTGTGAATATATTTTATGCCTTGACTCTGCAAAAAATCTGCTTACAAAGCACTGAGTACAGTTAAGAGAAAAT