Transcript asmbl_40295

Sequence
Transcript Sequence for observation asmbl_40295 of TGE0003585:
CGCCCACAGCGGGGAGCCAGGGGAGCACGGGGTCAAATTCACGTTAGACCCGCCCCCCAGCGCGTGGTTGGAGAGGGCTTGTCCCGGGGCTGCCCCGCCGCAGAGGTCCCTGTGACCCCAGACCAGGCGCTGTCCCCGCCCGGCCCTCGTGTGCAGGACTGCGCTCGGGCCCTGCCAGAGCCCCGGTTCCGCGCGGCCGATGTCCCAGCCGCCGGAAGTTGCCCGAGGCTCGCCGAGCGCCTCTGAGGAGCCCGGCGTCGCGCAGGCAGAGTGGCCACTGCAGTGGGTGTAGATGTGCCTGACGAGATGAAGAGCCGAATCCCTGTGGTGCTTTTGGCCTGTGGCTCCTTCAACCCCATCACCAACATGCACCTGCGCTTGTTTGAGGTGGCCAGAGACCACCTACACCAAACAGCTGTGCCTGAACTGAAGCTCCTCTGCGGGGCAGATGTCCTGAAGACCTTCCAGACCCCTGACCTCTGGAAAGACGAGCACATCCAGGAAATAGTGGAGAAGTTCGGCTTAGTGTGTGTGGGCCGGGTAGGTCACGACCCAAAGGGGTACATCTCAAGCTCCCCCATCCTTCAGAGATACCAGCACAACATTCACCTGGCCAGGGAGCCTGTGCAGAACGAGATCAGTGCCACGTACATCAGGCGGGCCTTGGGCCAAGGGCAGAGCGTGAAGTACCTGCTCCCAGACGCTGTCATCGCCTACATCAAGGACCACAACCTTTATACCAGGGGCAGTTCCTGCAAAGGCAATAACACCCAGAACAACTTAGGAAAGACAAGCTAGGGAGGGCCAAACCCTCCTCCACCAAGCTCCTCCTGAGGAGAGGGCCGTTAAGGTCTTTCCTTTTTTTCAGCTTTTTCCTTTTTCCTTTGTTCTAGTTCAACAATGATTTTACTTCTGAAGAGTCTTCTATCCCAGAAAGAGATAACTTCTTTTGGTAGGAGCTAGTATCTACACAAGAATAGACGTTTATCAAAAAAGTTCAAATGGTGTAGCAGGTCATTAGGATTGGGCGAAAGCTCTCAGAATCTCTGGGTGAAGAGACCTGCTTATTTTGTAAATGGTTGTATGCACACTGGAGGTGGTTCCACGTATGGCAGGGGCCCCTGACGGTCAGATCAGAATTGCCCACAATGCATTTTTTAACTAGGACCAGGTGCAGCATGCTGGTCATGATTAGAAAAACTGGACAGAATGCTAATTACCAAACAGTGGGCTATGTCAACGCCATGTTGAAAACGAAATAATAACCGAAGAGTCAAAAACTTGGAAGCAGCACTTTGCTGATTTACAGTGAATCTTCTGTTAAGAACCGTGCTCTGCCTGTCCCCTGGATGTTGATAAAATTTAAACTAAAATTTTTCTAAGTAGTGATCCTCCAACTATTTTTGAAACAGCAAATATTTTTAGTGCAGCTCTTCTATAAATATCAGGGCTCCTGGTTTCCAGGTTCCTGAAAAGGAACTGGGGTAAGACAGATGCCTTGACTGTCTTAGAGGATCTTTTTGAATGTTTTATGATTGCCTGCCTGTTTGAGTATTGGCAAAGGGCTAAATAATAAATAGACATCAAAAAGTA