Transcript asmbl_38682

Sequence
Transcript Sequence for observation asmbl_38682 of TGE0003561:
GTACACACTGAGCCCTGGTCACTTCAAAAGTTGAGAGGCGAGGAAAAAAGTTTTACAAACAAAACTATTCAATCTGTTGTAACCTCTTTCCACACAGTAATACACTTAGAAAACATAAAGTCCACTTTCAAGCCATTTAAACACAGTTGCTCCCTCTGAAAGGTCAGAGAGCGCGTCATCTCCTCGCCCCAAATGCAGCAAGCAAAGTCCTTCCTGTGTCTCGTGGGGCCTCGAACTCCAAGCCGGGTCCTTGCGACCCGCCGAGGCGAGCTCCGAGAATGGTGGTGTCTGGGGAGCTAAGGGCACAGCTCGAGGCTGACCGGAGTCCACCCGGGCTAGGCCACTGCTCCCCCGATTGGTGGCTCTAGCCCTGGTTTCCTGGGGAGCGAAGGGGTAGGCGGACAGAGGGAGGACGCGTCACGGGAAGCGTCCGTGGGCCAGGCGGGGAAGGGATACCAAGGCAAGAGCGAGAGCGCGCGCGGACCGAGGGCTCGGAGCGGGGCGTGGGGGTCGCAATCCGCCAGTTCCGCCCGCCGCTTCCGGCGCCCCGCGGTCCCGCCCCGCGCCGGCGGTGCCACATCCTCCGGTGACGTCAGCCAGCGCCGCCATATTGGAAAGGCGCCGCCGCCGCCGCTGTTTCGTAGCCGGGGCTGCGGCCGCAAGAAGAAGGATCTCCCTCTCGCTCCCCGCCGGCGCCTGGCCCGCCCGCTACGCCCCGACGCGTCTCCCATGCCTGCCCCCGGCCCGGCTGCCGACGGACGTCGCGTCAGCGCCCGGATTTAACACGGAAGCCCGGGTCGGGGGCCGCGGGGGGAGGACGAGGGAGACCCGGTAGGTCCCGCGCCCTTCTCGGCCCGGCGCGGCGCCTCGGCGGGAGCCATGACCTCGCTGACCCAGCGCAGCTCGGGCCTGGTGCAGCGGCGCACCGAGGCCTCCCGCAACGCCGCCGACAAGGAGCGGGCGGCGGGCGGCGGCGGCGGAGGCAGCGGCGAGGACGACGCGCAGAGCCGCCGCGATGAACAGGACGACGACGACAAGGGCGACTCCAAGGAAACGCGGCTGACCCTGATGGAGGAGGTGCTCCTGCTGGGCCTCAAGGACCGAGAGGGTTACACATCTTTTTGGAATGATTGTATATCATCTGGATTACGTGGCTGTATGTTAATTGAATTAGCATTACGAGGAAGATTACAACTAGAGGCTTGTGGAATGAGACGTAAAAGTTTGTTAACAAGAAAGGTGATCTGTAAGTCTGATGCCCCAACAGGGGACGTTCTTCTTGATGAAGCTCTGAAGCATGTTAAGGAGACTCAGCCTCCAGAAACAGTCCAGAACTGGATAGAGTTACTTAGTGGTGAGACGTGGAATCCATTAAAACTGCATTATCAGTTAAGAAATGTGCGGGAACGATTAGCTAAAAACCTGGTAGAAAAGGGTGTACTAACAACAGAGAAACAGAACTTTCTACTTTTTGACATGACGACACATCCCCTCACCAACAACAACATTAAGCAGCGCCTCATCAAGAAGGTTCAGGAAGCTGTTCTTGACAAATGGGTGAATGACCCTCACCGCATGGACAAGCGCTTGCTGGCCCTCATTTACCTAGCCCATGCCTCCGATGTTCTGGAGAATGCTTTTGCTCCGCTTCTGGATGAGCAGTATGATTTAGCTACGAAGAGAGTGCGGCAGCTCCTTGACTTAGATCCTGAAGTGGAATGTCTGAAGGCCAACACCAACGAGGTTCTGTGGGCGGTGGTGGCAGCATTCACCAAGTAACTCTGCTCAGAATGAAGTATTCTCCTTCCTCTCATGTAAACCAGTAGTTTTTCTTCTATTGACTTCTGGTTTTCTGCAGTTTGTATTTTCCCACACTATAATTGGCTTTTATTTTATGAAATAGTAAGTGGCTTTTTAAAAATATATATATATGTATGCAGGATTCTGCTGGTACGAGAGGCCTTCCTCTTTCTGTTTTAAAAAAAGTTTTACTGCCATATTGGCATTCCATTCCTTGTTGCCATTCTCACCATTACCTGTTTGGGGTTTCTGGTATGCTTTGACTTTCAAAGTACCTCCAGTCTCCTTACATGCACATCTTTTGGATTACCTCAGGTTGAGTTGTTCCCACATGTGCATGCACATCTCATATTCTGCCTACAGTTCAGACGGAAGTCACAAAAAGGCCTTTAACTCACCAAAGGTAAATATCTTTATCTATTAGGACATTTTATACATAGACCTCAGTTGAGATGTATACTTAGCAAAATTATTTTTAAATTGAAACAACACAGTAAATAATATAAAATGCCCCTTGGATTTTGCTTCCCATACGAATCTATTATAAGACTTGTTATAATTTTAACTATTAAATCACAAAGGTCCAGTCGTTTCACAAAGCCAGTTTGGGATAGGCTGCATTCCAGTTATGCTGTATATAGTTTGAATTATATATAAATTGCCCCTTCTGGCCACCCCACCTCCATCTTAGTATTTTGCAAGATTTAATTAGTTGCACACCTGGTGCCCCTCACTTGCTTTAGTCATTATTTGATGGCAAAATAGACCCCTCATCATTGAAGGAGAGAGAGGTGTGTCTGGTCCTGATATTTTTTTAGCTGTGCCATTCATGGCACTCTTTGCCTATGCATCT