Transcript asmbl_37285

Sequence
Transcript Sequence for observation asmbl_37285 of TGE0003554:
CAGGGACCGCCTACACCTGCGACGGACCACGGAGCAGCACGTGCCGGAGGTGGGCGTCCAGGTGAAGCGGAGGAGGACGGCGTCGCTGAGCAGCCACGAGTGTCCGCTGTACCCGAGGCGGTCCCAGCAGCAGGAGCCCGTGGTGGACTTCCAGGCGGAGCTGAGGCAGGCCTTCCTGGCCGAGACCCCGAGGGGTGGCTGAGGCCATCCTGGACGTCCAGGTAGCCGCTTCCGAGTGCAAAACAGGCCCCGTGCTCTGCCGCCGCTGCCCGCTGCCCGGCTGGCGTTGTCTGTGGCAGGACCTGTGCCGTCCCTGGTCTGTAGCCCTCCCTCAGGTCGGCGGTCCCGAGCTTCACCGCGAACGTCGGATCCGGTGGGCCTGCAATCATGACGGTGGGCAAGAGCAGCAAGATGCTGCAGCACATCGACTACCGCATGCGCTGCATCCTGCAGGACGGCCGCATCTTCATCGGCACCTTCAAGGCCTTCGACAAGCACATGAACTTGATCCTCTGCGACTGCGACGAGTTCCGGAAGATCAAGCCAAAGAACGCGAAGCAGCCGGAGCGTGAAGAGAAGCGGGTTTTGGGTCTGGTGCTGCTCCGAGGGGAGAACCTGGTCTCCATGACGGTGGAGGGGCCGCCCCCCAAAGACACCGGCATCGCTCGTGTGCCCCTCGCCGGAGCTGCAGGAGGCCCTGGAGTTGGCAGGGCCGCGGGCCGAGGAGTGCCAGCCGGCGTCCCCATTCCCCAGGCTCCTGCTGGATTAGCAGGCCCTGTCCGAGGGGTTGGGGGACCGTCCCAGCAGGTGATGACCCCACAGGGACGAGGCACTGTGGCAGCTGCGGCCGTCGCCGCTACCGCCAGCATTGCCGGAGCCCCAACGCAGTACCCACCAGGTCGGGGGACGCCCCCCACCCCTGTGGGCCGAGCCACCCCACCGCCAGGCATCATGGCTCCTCCCCCTGGCATGAGGCCACCTATGGGCCCACCAATCGGCCTTCCCCCGGCCCGTGGGACACCGATAGGCATGCCCCCCCCAGGCATGAGACCCCCGCCACCAGGAATCAGAGGCCCGCCTCCCCCGGGAATGCGCCCCCCGAGGCCCTAGGACGCTGTCGGTCCTCGGTCACCCCCGCAGTGCGTCTCGTGAAACCGTGTAGAGTGTTCGTGAGCCTTTGTTTCCTCTGCCGCCTCCGTGTTCGCCAATAAACGCATAAGCATGTCCACTGCGAGGCGCTGTTGTACGTTCTTTGCCCGTCGCGTCCCTTGAGGCCGGCGTGACGGGCTGTCCTCGAGCTTGTCCTGGGCGAGGAGGCCCTGTTACGCCACGCGTGTGGACAGGCTGCTCTGTAACCCGCAGGGCGGAACGGTGTGTGGCCTGTGTCAGCGCCTCGATTCAGCTAACGACCGTCACACGCGGGGACACTCCTGACTCAGGGGTTAGGCGGTTGGGGG