Transcript asmbl_35434

Sequence
Transcript Sequence for observation asmbl_35434 of TGE0003530:
AGCATCCATTGAATTTATTCGACGTAACCACAGAGGTACCGTCTTCATACCGCCACACAGACACAAACACAGCCACAGCACAATGTCCATATCGGCGCAGGCGCACTCCTTCTGCGGCTCATTTATACGTCTTCATGTGCCACAGTCCGTCGTTTAGATAATGGATATTTTCGATGCCGATCCCCTTGTTGACTTTCTCGATGTCTTCCGCAGACATCTTCATGACTCCGACACACAGGGCGTGCTGTTTTCCTTCCGCCATGATGGCCACCACCGTATCCACCGCGGCAGGGTACAGCTTGGCCCCGGGAGACGTCAGGCCTGGACACATGATGTTCGCGCCACTGAGGACAAATTTGATGGCTCCTTTATCCACCTGCTGGCGCGGCAGGATAAACGGGTACTTGTGGAGCAGCCTCAGCGTCGGGTAAAAAGGCCCTTCTCTTTGTCTAAAAAACAGCAGCTCCCCGTTGACCGTGAGGATCTCTATGTGCTCGTGGCACCGCACTATTTTGACGGGGTCTTTCTTGGGCATGATTTGGTTAAGCCACGGTTCGATGCCTGGAAACTGCTCTGTCAACTGGTTCTTAATGCCCTTAATAACGGACGTTTTCAGCTGGATGCAGTTGGACACGTTTTCCTTCTCGTCGAATTTCTTGAACATGATCCAAGGTGAAGGGGGCGACAGTACGGAAACGCCCGCAACCAGGGAAAAGCTGATCCCGCGAGGCTCGGGCAGGAGCGCTTACCCGCGGAGCGCCGGCGAGACGGTCGCGGCGGCTGTCGTGACCCGGAAGTGGACGTGCTTTACGGCTCTGCGTCAGGTCTACTTCCGGCCCGGGAGCGCGGCG