Transcript asmbl_35349

Sequence
Transcript Sequence for observation asmbl_35349 of TGE0003523:
GAAAACTATTCTCCTAATTTGGGAAGGGCTGGGCGCGCGCCGAGAGTGGAGCTGCGCGTGGCTCCGAGTGCGCCTGCGCGGAGCGCCGGGACAGGGCGTGTTCCTCGTTCGGGTGCGCGTCTACCTCAGGCGGGCTGCGGTTTTCCCTCCCCGCAGTCGTGCGCCCTGCGGGACCCCGTCATTTCTACGCCCAGCCTGATACGTGCCGCTCTCCGCGATCATGTCCAAGTCTCTGAAAAAGTTGGTGGAGGAGAGCCGGGAGAAGAACCAGCCGGAAGTGGACATGAGTGACCGCGGCATCTCCAACATGCTGGATGTCAACGGCCTGTTCTCCTTATCCCACATCACGCAGCTGGTCCTCAGCCACAACAAGCTAACAACCGTGCCACCTAACATAGCGGAACTGAAGAATCTGGAAGTGCTCAACTTTTTTAACAACCAGATTGAGGAGCTGCCCACACAGATCAGCAGCCTTCAGAAACTCAAGCACCTGAACTTGGGCATGAACAGACTAAACACTTTGCCTCGAGGATTTGGCTCCCTCCCAGCCCTTGAGGTCCTTGATTTGACTTACAACAACTTGAATGAAAATTCTCTTCCTGGAAATTTCTTCTACCTGACCACCCTGCGTGCACTCTATCTAAGTGACAACGATTTTGAAATCCTGCCGCCAGATATTGGGAAGCTCACAAAGTTGCAGATACTCAGCCTTAGGGATAACGACCTGATCTCGCTGCCTAAGGAAATCGGGGAGCTTACTCAGCTTAAGGAGCTCCACATTCAGGGGAACCGCCTGACCGTTCTGCCCCCAGAACTAGGAAACTTGGATCTGACTGGTCAGAAGCAGGTATTCAAAGCAGAGAACAACCCCTGGGTCACCCCGATCGCTGACCAGTTCCAGCTTGGTGTGTCCCATGTATTTGAGTATATCCGTTCCGAGACGTACAAGTATCTCTACGGCAGACACATGCAGGCAAATCCAGAACCGCCGAAGAAAAATAATGACAAAACGAAAAAGATCAGCCGGAAGCCTCTGACAGCCAAGAACAAATGAGGGGTTGGCATGGGCTGGACTTCCGGTCACTTCGCTCGTTATTACTTCTGTTCTCTTGCTCTGTCCCACGATCAGTTATGGTTGACCCTTGAGCAACTTGGGTTTGAACTGAGCGGGTCCATTATATGCAGATTTTCTTCAATAAATTCTGCAAATGTATTTTCCTAATGATTCTCTTAAGATTTTCTTTTCTCTAACTTTGGTATAAGAATACAGTATATAATATGTATAACATACAAAATAGGTGTTAATAGACTGTTTACGTTAATAGACAGGAGGCTATCAGTAGTAAAGTTTTGGGGTGTCAGGTTATATGTGGATTTTCAACTGTGTAAGGGGGCGGCACCCCAACCCTCACATTGTTCAAGGGTCAACTGTACAGTGTGTATCTCTGAGTGTGTGTGAGTGCATGTGTTTCTTTTCATATTTTTCTTCCTACTGCTTACCAATTTTTATCTTTTAATTTCTTTTGGTAGGTAGTAGATTTTTATAAGTTTTAAAAACCCTTTCTTACCTTAAAAATTACCAAAGGCAGGAAACAAAGCTCTGATTCAACTGCTAATTCCGTAGTAGGCACTGATTTCAGCTCCTTGAATAGATGCTCGTAAAGTCGCTGCTTATCAAAAGCATAATTAAAATCACGTAATCGTTTAAATGTCACAGCACTGTTCACGCTTCTGTTTATTCATGTAATTCATTCTTTCGCCTTATTAAAAATTTTCCTTCGCCACTGAGATATTATGTTAACTTTCTTCACATACGATTTTAATAAAATCTTGAATTTGCACAACGTGTTGCCTCCTGAATACAGAACAATCTGACTTTGGGGTGTATACACATTTTTGTTTACTCTTTTTCCCAAAATTAATCTTGTCCACTTTTATTGGTTGTAGATGATAAACCCTGAAACTTCTCATGAAAAAAATGCAAAATTAAAGTTAGTTTCTTCTCACGTTGGTTTGTCAGTTTTATTTTATTTTTTTTCTTTGAAGACTGTTGCTAAATTAGGAAGGAGGAGAAAAACAAATCTCCGGGAGC