Transcript asmbl_35118

Sequence
Transcript Sequence for observation asmbl_35118 of TGE0003540:
CGCTCCAATCTCGGGCGCTCTTTGTTTCCTTCTCGGCGCCTTCCAAGCTGCTGGGTCCCTCACTCCCCCCTTCCTGCTCCTTTGCCTGCGGGTCTCCCCTCCCGCCCGCTCCCTGCAGACCGCAGGCGCGTCGCCGCGCGCCCCTCCCACTCGCGCTCCTCCTCCCACGCCTCTTTGGCGCGCCGGCCCAGGACCCCTTTGATCCAGTCCCAGGCGCGTTCCCCCACCACTGTGCGACCCCGCCTTTTTCAACACCCTGGGGTGAGCCGAGCTTGGGCCAATATCAGGAAAGCCCCTGAAAGTCCCAGCCCAGCCAAGAAGTAACAGGACCCTGCCCAGTCCCGGGAGCAGAGCGGCCAGGAGGAGGAAGGCTCCAAGGCGCCCCCGCCCTCGGGTCCGCTACTTGCCGGGTCCCTATTGGCTGGCGCGCTCGGCGACTGAAACAGCCGTGGGAGGGGAATTCTCGTTTATAAAAACTGCGCCCTTGGCAGGGTCCCGTCCTCTGCAACTCTTGCTCCGGGGTCCCCGCGCCAGAGACGCAGCAGCGCTCCCACCGCCCACACCCACCGCGCCCTCGCTCGCCTCTCCGCCGAAAGCCAGTCCGCGCCGCCGCAGCTGCCCAGCCCGCCACCACCCTCCGCAGTCATGTCCACCAGGTCCGTATCCTCGTCCTCCTACCGTAGGATGTTCGGCGGCCCAGGCACCGCCAGCCGGCCGAGCTCCAGCCGGAGCTATGTGACCTCGTCCACCCGCACTTACAGCCTGGACGGCGCGCTGCGCCCCAGCACGGGCCGCAGCTTGTACGCCTCGTCGCCCGGCGGCGTGTATGCCAAGCGCTCCTCGGCTGTGCGCCTGTGGAGCGGTGCCCCCCGCGTGCGGACGCTGCAGGACTCGGTAGACTTCTCGCTGGCCGACGCCATCAACACCGAGTTCAAGAACACCCGTACCAACGAGAAGGTGGAGCTGCAGGAGCTGAATGACCGCTTCGCCAACTACATCGACAAGGTGCGCTTCCTGGAGCAGCAGAACAAGATCCTGCTGGCCGAGCTCGAGCAACTCAAGGGCCAGGGCAAGTCGCGCCTGGGGGACCTTTACGAGGAGGAGATGCGGGAGCTGCGCCGGCAGGTGGACCAGCTCACCAACGACAAGGCCCGCGTGGAGGTGGAGCGCGACAATCTGGCCGAGGACATCATGAGGCTCCGGGAGAAGTTGCAGGAGGAGATGCTTCAGAGAGAGGAAGCCGAGAGCACCCTGCAGTCCTTCAGACAGGATGTTGATGGTGCTTCTTTGGCACGTCTTAACCTTGAGCGTAAAGTGGAATCCTTGCAGGAAGAGATTGCCTTTTTGAAGAAACTCCATGACGAGGAAATCCAGGAGCTGCAGGCCCAGATTCAGGAACAGCATGTCCAGATCGATGTGGATGTTTCTAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAGTATGAAAATGTGGCTGCCAAGAACCTTCAGGAGGCTGAGGAATGGTACAAGTCCAAGTTTGCTGACCTCTCCGAGGCTGCTAACCGGAATAATGATGCCCTGCGCCAGGCGAAACAGGAGTCAAATGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGACGCGCTGAAAGGATCTAATGAGTCTCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCTATGGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAACATGAAGGAAGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTGAATGTTAAGATGGCTCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGATTGCTCTGCCTCTTCCAACCTTTTCTTCCCTGAACCTGAGGGAAACCAATCTGGATTCGCTCCCTCTGGTTGACACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAATGAAACTTCTCAGCATCACGATGACCTGGAGTGAAAATTGCACAGAGTTGGTGCAGCAATATTATTACCAGCAACAATAAAAAAGAAATTCATTTCTTAAAGAAACAGCTTTTAAGTGCCTTTCTGCAGTTTTTCAGGAGCGCAAGATAGATTTGAAATAGAAATAAGCTCTAGTTCTTAAGAACCAACACTCCTAAAAGATTTAGAAAAAAGTTTACAACGTAATCTAGTTTATGAAGAAGTCTTGTGCTAGAATACTTTTTAAAAAGTATTTTTGAATACCATTCAAACTGCTTTTTTCCAACAAGTATCTGACCAATGTGTCTCTGCTTCAATAAATCTTTGAAATCTG