Transcript asmbl_35114

Sequence
Transcript Sequence for observation asmbl_35114 of TGE0003539:
GGGGAGACTCTCAAGGTCCGGGAAGTGAGCCCTGCGGTCTCGGGGGAGGAGGCAGCGCGCAGGGAGCAGCGGGAAGGCGCTCGGGAGCCGGAGCGGGCGCGGCGGCGGTGGGCCCGAAAACACTAGAATCTTCTGGTGCCATCAGAAATGTCTCCCTTAAGTGGCAAAGTCCAGACTGTCTTGGGGCTGGTGGAGCCGAACAAACTGGGCCGCACCCTGACCCACGAACATCTGACAATGACCTTTAACTGCTCTTACCACCCACCGCCTCCATCTCATGAAGCTCTCTCTCGGGAGCCTATTATGATGAAAAATTTGTTTTGGATTCAGAAAAACCCTTACTCCCATAAAGAGAATCTTCAGCTGAATCAGGAGACGGAAGCCATCAAGGAAGAACTGTTGTATTTTAAAGCCAAAGGTGGAGGGGCCTTGGTGGAGAACACGACCACTGGGATCAGCCGCGACGTGCAGACTTTGAAGCGGCTGGCGGAAGAGACGGGCATTCACATCATATCTGGAGCTGGGTTTTACGTGGATGCAACTCACTCTTCTGAGACCAGAGCCATGTCGGTGGAGCAGCTGACTGACGTCCTCGTTAATGAAATTCTCCATGGAGCTGATGGGACCAGTATCAAGTGTGGCGTTATTGGAGAAATCGGTTGCTCCTGGCCTCTGACTGACAGTGAAAGGAAGGTTCTCCAGGCGACGGCTCATGCCCAGGCCCAGCTCGGCTGTCCTGTTATCATTCACCCTGGAAGGAATGCAGCCGCACCCGTTCAGATCATCCGAGTACTGCAAGAAGCAGGTGCAGACATCTCCAAAACAGTTATGTCGCACATCGATAGGACTATACATGATAAGAAGGAACTACTGGAGTTTGCTCAACTTGGCTGTTACTTGGAATATGATCTCTTTGGTACCGAACTCCTTCATTACCAATTCAACCCAGATATTGACATGCCTGATGATAATAAAAGAATTAGAAGGGTGCGTCTTCTGGTGGATGAGGGCTATGAAGATCGAATTCTGATGGCACACGACATACACACGAAGCACCGGCTGATGAAATACGGAGGTCACGGCTATTCTCACATACTCACCAACGTTGTCCCTAAAATGTTGCTCAGAGGTATAACTGAGAATGCGCTTGATAAGATACTGATAGAGAACCCTAAGCAATGGCTGACTTTCAAATAGGATGGTTAGGAATTCACACCTTGAGCATAAAGCTTACAGAGATCATCCGGTGGTTTCGAACCCAGTGAGTTATCAATCAGACCTACATAGGGCTAATGACAGATCATTTGCATTTTATGGGAATTAGAAGAGTTTTCCCTTCTCAGAAACTGGCTATTACATCTGAACCTGCAAGGGGCCTCACTCAGCCCACTGCCTTAACAAAATAAATACACAAAATACCTATTTCCAAACCATGATTTACAGTCTATATCCTCTTGGTAGAGTTTTGTTTTGTTTTGTTTTCTTAATCTATCAGCTGTACTACTTGTGAAAATTTAAAGTGTTTCTAGTTAAATTACCCCCTTCTGGAGCAATCTAATGTTTCTTGTAGTATTGATGATCCTACTAATTATCCTGCTGTTCTTTAATTAATGCTTAATGAATAATATGGCACTTTAAAATAAAACAGCTTCTGCAGCAAGGGAAGTTAAATTCTGAGATTTCTTTTCAACGAATACTGTTAAGACAAATACCAATTCAACAATGGTAAAACTATTGTGGAAAGATAATTATATGCTGTCCACCTGTCTGTACATAATTATAATAAATCCTCAGTGTTGCCTGTGGTGTTCTGGTATCCATTTTTGCTAAAAATTTTGTTGTGCTTTGAAAAATTTACATACGGGGACACAAACACATAACATAGTACTGAATTATAAAAATTCAATCATAAAAAGTCAAAATATATTACATAATATAGTTTAATGAATCATTACATTTATAATAACAAAGGCCACAATTTAATTAATAATGTATAAT