Transcript asmbl_34932

Sequence
Transcript Sequence for observation asmbl_34932 of TGE0003509:
CTCGGGCTCAGCGGCCGCCATCTTGTGTCGGCGGTGGAGGTGAAGGAGGTGGCAGGGACGAGCACAACTACTACCGCCGGGGGAGGATAAGGCGGCGGAGGCGGCGGCGACTCTAGGCGGCCCAAGCGGCGGGGAGGAGGAGGAGGAGAAAGAGGAGGGTGGCTTGGCTTCGGCTCCTAGAGGAGTTGGCGGCGGCGCGACCCGGGGAACCGGCATTGATGTCCAGCTCGCCGCTGTCCAAGAAACGTCGCGTGTCCGGGCCTGATCCAAAGCCGGGTTCTAACTGTTCCCCCGCCCAGTCTGTGTTGTCCGAAGTGCCCTCGGTGCCAACTAACGGAATGGCGAAGAACGGCAGTGAAGCAGACATAGATGAGGGCCTTTACTCTCGGCAGCTGTACGTGTTGGGCCATGAGGCAATGAAGCGGCTCCAGACATCCAGCGTACTGGTATCAGGCCTGCGGGGCCTGGGCGTGGAGATTGCCAAAAACATCATCCTTGGTGGGGTCAAGGCTGTCACCCTACATGACCAGGGCACTGCCCAGTGGGCTGACCTCTCTTCCCAGTTCTACCTGCGGGAGGAGGACATTGGTAAAAACCGGGCAGAGGTCTCCCAGCCCCGTCTTGCTGAACTCAACAGCTACGTGCCTGTCAGCGCCTACACTGGGCCTCTTGTCGAGGACTTCCTTAGTGGCTTCCAGGTGGTGGTCCTCACCAACACCCCCCTGGAGGACCAGCTTCGGGTGGGTGAGTTCTGTCACAGCCGTGGCATCAAGCTGGTGGTGGCAGACACACGGGGCCTATTTGGACAACTCTTCTGTGACTTCGGAGAAGAAATGATTCTCACTGATTCCAATGGAGAGCAGCCACTCAGTGCTATGGTTTCTATGGTCACCAAGGACAACCCCGGTGTGGTTACCTGCCTGGATGAGGCCCGACATGGGTTTGAGAATGGCGACTTTGTCTCCTTCTCAGAAGTACAGGGCATGGTTGAACTCAACGGAAGTCAGCCCATGGAGATCAAAGTTCTGGGTCCTTACACCTTTAGCATCTGTGACACCTCTCACTTCTCTGACTATATCCGTGGTGGTATCGTCAGTCAGGTCAAAGTACCTAAGAAGATCAGCTTTAAATCTTTGCTGGCCTCACTGGCAGAGCCCAACTTCGTGATGACAGACTTTGCCAAGTTTTCCCGTCCTGCACAGCTGCACATTGGCTTCCAGGCCCTGCACCAGTTCTGTGCTCAGCACGGCCGGGCCCCTCGGCCCCGCAATGAGGAGGATGCAACAGAGCTAGTGACCTTAGCCCAGGCCATGAATGCTCGAGCCCTGCCAGCAGTGCAGCAGGACAGTCTGGATGAGGACCTCATCCGGAAGCTGGCATATGTGGCTGCTGGGGATCTGGCACCCATAAACGCCTTCATTGGGGGCCTGGCTGCCCAGGAGGTCATGAAGGCCTGCTCTGGGAAGTTTATGCCTATCATGCAGTGGCTATACTTTGATGCTCTGGAGTGTCTCCCTGAGAACAAAGAGGCCCTCACAGAGGACAAGTGCCTCCCGCGCCAGAACCGTTACGATGGGCAGGTGGCTGTATTTGGCTCAGACCTACAAGAGAAGCTGGGCAAGCAGAAATACTTCCTGGTGGGTGCAGGAGCCATTGGCTGTGAGCTGCTCAAGAACTTTGCAATGATTGGATTGGGCTGTGGAGAAGGCGGAGAAATTGTCGTCACAGACATGGACACCATTGAGAAGTCAAATCTGAACCGACAGTTTCTCTTCCGGCCCTGGGATGTTACGAAGTTAAAGTCTGACACCGCTGCTGCAGCTGTGCACCAGATGAATCCACACATCCAGGTGACAAGCCACCAGAACCGTGTGGGCCCTGACACAGAGCGCATCTATGACGATGAGTTCTTCCAAAACTTGGACGGTGTGGCCAATGCCCTGGACAATGTGGATGCTCGCATGTACATGGACCGCCGCTGCGTGTACTACCGTAAGCCGCTGCTAGAGTCAGGCACACTGGGCACCAAGGGCAACGTGCAGGTGGTGATCCCCTTCCTGACAGAGTCGTACAGCTCTAGCCAGGACCCGCCTGAGAAGTCCATCCCTATCTGCACGCTGAAGAACTTCCCCAACGCTATCGAGCACACCCTGCAGTGGGCTCGGGATGAGTTTGAAGGCCTTTTCAAGCAGCCAGCAGAAAACGTCAACCAGTACCTCACAGACCCCAAGTTTGTGGAGCGGACCCTGCGGCTGGCGGGCACCCAACCTCTGGAGGTGCTGGAGGCCGTGCAGCGCAGCCTGGTGCTGCAGCGGCCACAGACCTGGGCTGACTGTGTGACCTGGGCTTGTCACCACTGGCACACTCAGTACTCTAACAACATCCGGCAGCTGCTGCACAACTTCCCTCCTGACCAGCTCACGAGCTCAGGAGCTCCGTTTTGGTCTGGGCCCAAACGCTGTCCGCATCCGCTCACCTTTGATGTCAGCAATCCCCTGCATCTGGACTACGTGATGGCTGCCGCTAACCTGTTTGCCCAAACCTACGGGCTGACGGGCTCTCAGGACCGAGCTGCGGTGGCCGCCCTCCTACAGGCTGTTCAGGTCCCCGAGTTCACCCCTAAGTCTGGCGTCAAGATCCACGTCTCTGACCAGGAGCTGCAGAGTGCCAATGCCTCTGTTGATGACAGCCGTCTAGAGGAGCTCAAGGCCACACTGCCTAGTCCAGAAAAGCTCCCTGGATTCAAGATGTACCCCATCGACTTTGAGAAGGATGATGACAGCAACTTCCATATGGATTTCATTGTGGCTGCATCCAACCTTCGGGCAGAGAACTATGACATTCCCCCTGCAGACCGGCACAAGAGCAAGCTGATTGCAGGGAAGATCATCCCAGCCATAGCCACAAGCACAGCAGCTGTGGTTGGCCTTGTGTGTCTGGAGCTCTACAAGGTGGTGCAGGGACACCGACGGCTTGACTCCTACAAGAATGGTTTCCTCAACTTAGCCCTACCCTTTTTCGGCTTCTCTGAACCCCTTGCCGCACCCCGTCACCAGTACTATAACCAAGAGTGGACGTTGTGGGATCGCTTTGAGGTACAGGGGCTGCAGCCTAACGGTGAGGAGATGACCCTCAAACAGTTCCTTGACTACTTTAAGACAGAGCATAAATTGGAGATCACCATGCTGTCCCAGGGTGTGTCCATGCTTTACTCCTTTTTCATGCCAGCTGCCAAGCTCAAGGAACGATTGGATCAGCCGATGACAGAGATCGTAAGCCGTGTGTCGAAGCGAAAGCTGGGCCGCCATGTGCGGGCGCTGGTGCTTGAGCTGTGCTGCAACGACGAGAGCGGCGAGGACGTCGAGGTCCCCTACGTACGATACACCATCCGCTGACCCCCAGCCCCTCCTGTAGACTGGCCCCAGGCCCCCTCTCCAAACCCCTTCCAGCCCAGGGCTCCCAGTTGACCTCTGGCAGTGGCCCAGCTAGCCAAGCCTGGTGTTCCCTCTTCATCCCCCTACTTGAACCCCTCTTGCCGCTGCTTCCTACCTTGTTCAGAACCTGAATCCTAATAAAGAGTTATTAACCCAGATGTGGCATGCCCAGCTGGTTCCAGGGAAGAAAGGGACTTCCTGGAGCTGTATGGTTCAGATGGTAACCCAAAGGGCTCAGCCCTACCCCAACTGCCAGTTTCCTGGGCAGAGAAAATGTGGAAATGGCTACCTTCTTCCTCTTTTCCTCCCTGCCTAGGAAGAAGTGGAGGCACCAGTGAGGCCATAGGGAGCAGGTACCTGGGTCCAATTTATATGAGCTGGGTTTCAGTTCTATCTTCTCCATTGCCTAACTCTCTGCCATGTTGATGTTGGGTCAGTGTGGCTTATGTTCTTGGGGCAGATCCCTTTTCGCCTAGCTCAAAGCACTCAGACGCCGCACAAGCCTTTACTATCATGGTTCCCAGTGCCAGGAATGCTTGTAATGCCCTTAGTTCAACTTCCCTGCTGCAGGAGAGACCTCAATGGCTCTGTTGGACTGAGGAATGCCAGTGCCTGTGTATACTTAGTTTTTAAAAATATTTGGCTGAGAGCATCTGTAGAGGAAAAGCCCCTTTCCCACCCCACTCTGCCCGCCTAGGGCCTGATCTGCCTGTCCCAAGGCCTCATACATTTGAGAAGAGAGGTAGCTGTGGAGGCTGAGGGTTGTCGATTGGTCCGAGCAGGCAGTAGGAGCTTCACTTGAGGCCCTACCAGGACTGTACGCTCCATCTGTGGTCTTGGCTGGGCACTCCAGACATTTGAAAGCACCAGTCTGGCCACCTGGTACCTAAGAATTGCACTCATACCTCTATCCCTCACCCAACCACTTAGGAACAGATTCCTTATCCCTTTGCTCAAACCTGGGTATTGGGAATAGCACAACCTGTCCCTGAACCTAGCCTGACATCCATCACAGTGTGTTCCCACATCCTCTGCCTCCTGGGCCAGCTTCAGACCCCAGGTACCATGTATGCCCTTGCCCATCTCCCTCTCATGATTACTTTTTTTTCTTGGGTGACCTCATGCTTTCACACTTCTTTTTACTCCCCACCAGGATACTGGCGACTGAGGTACTTTACCTCTGGCATCTAGTTAGTGGTGATGCTAGCTGTCTAGGTCAAGTGGAGATTTTCCTACCACAAGCACTTTTTCCATATTGCTGTTTTGGAGTACTCCAAACACTCCACACCTCTGTCTACTGTCTCCACTGTTGCAGCATCTGAGGCTGCACAAATTTATTTCTTCTGTCCCCTTTCTCCACTATCCCAGCTCCTTCTTGGATATTCTAGATACTTTGTTCACTGGATCTTCCTCATTACAGCTCCTGATTCTCCAGACGCTTCTGTCCCTTATTTCAGCACCACAGCTCTTGATTCCCCTTGCTACTTTATTTGTACCTGACACATTTCATCAAGAACTCATGAATCCTGCTTGCATCTTATTTCCCCAATACGTGCCATTTTACTTCTCATGTTTGTCTACCTTATAACACCAGCAAGATGGACTAGGGTTCAGTGGGCAGGGGTTGGGTGACTGCACTGAGAGCCCCCTGCACCCAGCAGGTACAAAACACAGGTGGGACAAGGTCGTGTCCTCTTGTTTCTGCCTACAATTATTT