Transcript asmbl_34931

Sequence
Transcript Sequence for observation asmbl_34931 of TGE0003509:
CTCGGGCTCAGCGGCCGCCATCTTGTGTCGGCGGTGGAGGTGAAGGAGGTGGCAGGGACGAGCACAACTACTACCGCCGGGGGAGGATAAGGCGGCGGAGGCGGCGGCGACTCTAGGCGGCCCAAGCGGCGGGGAGGAGGAGGAGGAGAAAGAGGAGGGTGGCTTGGCTTCGGCTCCTAGAGGAGTTGGCGGCGGCGCGACCCGGGGAACCGGCATTGGATTGGCGTCTCTCCCTCATTATGCTGGGCTGGGGAGAAAGGCGAATGGCCTAGTGGTCAGCAGCATGGATTGCAAGCCAGACCACCTGGGTTCAGATCTTAGCTCTGACAGCTCTGTGACCTTGGATGTCCAGCTCGCCGCTGTCCAAGAAACGTCGCGTGTCCGGGCCTGATCCAAAGCCGGGTTCTAACTGTTCCCCCGCCCAGTCTGTGTTGTCCGAAGTGCCCTCGGTGCCAACTAACGGAATGGCGAAGAACGGCAGTGAAGCAGACATAGATGAGGGCCTTTACTCTCGGCAGCTGTACGTGTTGGGCCATGAGGCAATGAAGCGGCTCCAGACATCCAGCGTACTGGTATCAGGCCTGCGGGGCCTGGGCGTGGAGATTGCCAAAAACATCATCCTTGGTGGGGTCAAGGCTGTCACCCTACATGACCAGGGCACTGCCCAGTGGGCTGACCTCTCTTCCCAGTTCTACCTGCGGGAGGAGGACATTGGTAAAAACCGGGCAGAGGTCTCCCAGCCCCGTCTTGCTGAACTCAACAGCTACGTGCCTGTCAGCGCCTACACTGGGCCTCTTGTCGAGGACTTCCTTAGTGGCTTCCAGGTGGTGGTCCTCACCAACACCCCCCTGGAGGACCAGCTTCGGGTGGGTGAGTTCTGTCACAGCCGTGGCATCAAGCTGGTGGTGGCAGACACACGGGGCCTATTTGGACAACTCTTCTGTGACTTCGGAGAAGAAATGATTCTCACTGATTCCAATGGAGAGCAGCCACTCAGTGCTATGGTTTCTATGGTCACCAAGGACAACCCCGGTGTGGTTACCTGCCTGGATGAGGCCCGACATGGGTTTGAGAATGGCGACTTTGTCTCCTTCTCAGAAGTACAGGGCATGGTTGAACTCAACGGAAGTCAGCCCATGGAGATCAAAGTTCTGGGTCCTTACACCTTTAGCATCTGTGACACCTCTCACTTCTCTGACTATATCCGTGGTGGTATCGTCAGTCAGGTCAAAGTACCTAAGAAGATCAGCTTTAAATCTTTGCTGGCCTCACTGGCAGAGCCCAACTTCGTGATGACAGACTTTGCCAAGTTTTCCCGTCCTGCACAGCTGCACATTGGCTTCCAGGCCCTGCACCAGTTCTGTGCTCAGCACGGCCGGGCCCCTCGGCCCCGCAATGAGGAGGATGCAACAGAGCTAGTGACCTTAGCCCAGGCCATGAATGCTCGAGCCCTGCCAGCAGTGCAGCAGGACAGTCTGGATGAGGACCTCATCCGGAAGCTGGCATATGTGGCTGCTGGGGATCTGGCACCCATAAACGCCTTCATTGGGGGCCTGGCTGCCCAGGAGGTCATGAAGGCCTGCTCTGGGAAGTTTATGCCTATCATGCAGTGGCTATACTTTGATGCTCTGGAGTGTCTCCCTGAGAACAAAGAGGCCCTCACAGAGGACAAGTGCCTCCCGCGCCAGAACCGTTACGATGGGCAGGTGGCTGTATTTGGCTCAGACCTACAAGAGAAGCTGGGCAAGCAGAAATACTTCCTGGTGGGTGCAGGAGCCATTGGCTGTGAGCTGCTCAAGAACTTTGCAATGATTGGATTGGGCTGTGGAGAAGGCGGAGAAATTGTCGTCACAGACATGGACACCATTGAGAAGTCAAATCTGAACCGACAGTTTCTCTTCCGGCCCTGGGATGTTACGAAGTTAAAGTCTGACACCGCTGCTGCAGCTGTGCACCAGATGAATCCACACATCCAGGTGACAAGCCACCAGAACCGTGTGGGCCCTGACACAGAGCGCATCTATGACGATGAGTTCTTCCAAAACTTGGACGGTGTGGCCAATGCCCTGGACAATGTGGATGCTCGCATGTACATGGACCGCCGCTGCGTGTACTACCGTAAGCCGCTGCTAGAGTCAGGCACACTGGGCACCAAGGGCAACGTGCAGGTGGTGATCCCCTTCCTGACAGAGTCGTACAGCTCTAGCCAGGACCCGCCTGAGAAGTCCATCCCTATCTGCACGCTGAAGAACTTCCCCAACGCTATCGAGCACACCCTGCAGTGGGCTCGGGATGAGTTTGAAGGCCTTTTCAAGCAGCCAGCAGAAAACGTCAACCAGTACCTCACAGACCCCAAGTTTGTGGAGCGGACCCTGCGGCTGGCGGGCACCCAACCTCTGGAGGTGCTGGAGGCCGTGCAGCGCAGCCTGGTGCTGCAGCGGCCACAGACCTGGGCTGACTGTGTGACCTGGGCTTGTCACCACTGGCACACTCAGTACTCTAACAACATCCGGCAGCTGCTGCACAACTTCCCTCCTGACCAGCTCACGAGCTCAGGAGCTCCGTTTTGGTCTGGGCCCAAACGCTGTCCGCATCCGCTCACCTTTGATGTCAGCAATCCCCTGCATCTGGACTACGTGATGGCTGCCGCTAACCTGTTTGCCCAAACCTACGGGCTGACGGGCTCTCAGGACCGAGCTGCGGTGGCCGCCCTCCTACAGGCTGTTCAGGTCCCCGAGTTCACCCCTAAGTCTGGCGTCAAGATCCACGTCTCTGACCAGGAGCTGCAGAGTGCCAATGCCTCTGTTGATGACAGCCGTCTAGAGGAGCTCAAGGCCACACTGCCTAGTCCAGAAAAGCTCCCTGGATTCAAGATGTACCCCATCGACTTTGAGAAGGATGATGACAGCAACTTCCATATGGATTTCATTGTGGCTGCATCCAACCTTCGGGCAGAGAACTATGACATTCCCCCTGCAGACCGGCACAAGAGCAAGCTGATTGCAGGGAAGATCATCCCAGCCATAGCCACAAGCACAGCAGCTGTGGTTGGCCTTGTGTGTCTGGAGCTCTACAAGGTGGTGCAGGGACACCGACGGCTTGACTCCTACAAGAATGGTTTCCTCAACTTAGCCCTACCCTTTTTCGGCTTCTCTGAACCCCTTGCCGCACCCCGTCACCAGTACTATAACCAAGAGTGGACGTTGTGGGATCGCTTTGAGGTACAGGGGCTGCAGCCTAACGGTGAGGAGATGACCCTCAAACAGTTCCTTGACTACTTTAAGACAGAGCATAAATTGGAGATCACCATGCTGTCCCAGGGTGTGTCCATGCTTTACTCCTTTTTCATGCCAGCTGCCAAGCTCAAGGAACGATTGGATCAGCCGATGACAGAGATCGTAAGCCGTGTGTCGAAGCGAAAGCTGGGCCGCCATGTGCGGGCGCTGGTGCTTGAGCTGTGCTGCAACGACGAGAGCGGCGAGGACGTCGAGGTCCCCTACGTACGATACACCATCCGCTGACCCCCAGCCCCTCCTGTAGACTGGCCCCAGGCCCCCTCTCCAAACCCCTTCCAGCCCAGGGCTCCCAGTTGACCTCTGGCAGTGGCCCAGCTAGCCAAGCCTGGTGTTCCCTCTTCATCCCCCTACTTGAACCCCTCTTGCCGCTGCTTCCTACCTTGTTCAGAACCTGAATCCTAATAAAGAGTTATTAACCCAGATGTGGCATGCCCAGCTGGTTCCAGGGAAGAAAGGGACTTCCTGGAGCTGTATGGTTCAGATGGTAACCCAAAGGGCTCAGCCCTACCCCAACTGCCAGTTTCCTGGGCAGAGAAAATGTGGAAATGGCTACCTTCTTCCTCTTTTCCTCCCTGCCTAGGAAGAAGTGGAGGCACCAGTGAGGCCATAGGGAGCAGGTACCTGGGTCCAATTTATATGAGCTGGGTTTCAGTTCTATCTTCTCCATTGCCTAACTCTCTGCCATGTTGATGTTGGGTCAGTGTGGCTTATGTTCTTGGGGCAGATCCCTTTTCGCCTAGCTCAAAGCACTCAGACGCCGCACAAGCCTTTACTATCATGGTTCCCAGTGCCAGGAATGCTTGTAATGCCCTTAGTTCAACTTCCCTGCTGCAGGAGAGACCTCAATGGCTCTGTTGGACTGAGGAATGCCAGTGCCTGTGTATACTTAGTTTTTAAAAATATTTGGCTGAGAGCATCTGTAGAGGAAAAGCCCCTTTCCCACCCCACTCTGCCCGCCTAGGGCCTGATCTGCCTGTCCCAAGGCCTCATACATTTGAGAAGAGAGGTAGCTGTGGAGGCTGAGGGTTGTCGATTGGTCCGAGCAGGCAGTAGGAGCTTCACTTGAGGCCCTACCAGGACTGTACGCTCCATCTGTGGTCTTGGCTGGGCACTCCAGACATTTGAAAGCACCAGTCTGGCCACCTGGTACCTAAGAATTGCACTCATACCTCTATCCCTCACCCAACCACTTAGGAACAGATTCCTTATCCCTTTGCTCAAACCTGGGTATTGGGAATAGCACAACCTGTCCCTGAACCTAGCCTGACATCCATCACAGTGTGTTCCCACATCCTCTGCCTCCTGGGCCAGCTTCAGACCCCAGGTACCATGTATGCCCTTGCCCATCTCCCTCTCATGATTACTTTTTTTTCTTGGGTGACCTCATGCTTTCACACTTCTTTTTACTCCCCACCAGGATACTGGCGACTGAGGTACTTTACCTCTGGCATCTAGTTAGTGGTGATGCTAGCTGTCTAGGTCAAGTGGAGATTTTCCTACCACAAGCACTTTTTCCATATTGCTGTTTTGGAGTACTCCAAACACTCCACACCTCTGTCTACTGTCTCCACTGTTGCAGCATCTGAGGCTGCACAAATTTATTTCTTCTGTCCCCTTTCTCCACTATCCCAGCTCCTTCTTGGATATTCTAGATACTTTGTTCACTGGATCTTCCTCATTACAGCTCCTGATTCTCCAGACGCTTCTGTCCCTTATTTCAGCACCACAGCTCTTGATTCCCCTTGCTACTTTATTTGTACCTGACACATTTCATCAAGAACTCATGAATCCTGCTTGCATCTTATTTCCCCAATACGTGCCATTTTACTTCTCATGTTTGTCTACCTTATAACACCAGCAAGATGGACTAGGGTTCAGTGGGCAGGGGTTGGGTGACTGCACTGAGAGCCCCCTGCACCCAGCAGGTACAAAACACAGGTGGGACAAGGTCGTGTCCTCTTGTTTCTGCCTACAATTATTT