Transcript asmbl_34929

Sequence
Transcript Sequence for observation asmbl_34929 of TGE0003509:
CCTCGGAGTTCCGCTCTCTTTTCCCATCCCCCAGAGCACCGCTCCTGGAATTCCACAGCCCAGGGTGACATTTTCCCATCCCCTGGCCGCTGATGCCCACCACGTGCACGGGGCACTGGCTAAGTTGGACTACCACCCCCAGCATGCCTCGCGCTTTCGGGAAGGACCACAATCCGTAGGGGTGTCTGGATCTGACACAGGTCGTCGACGGCGCGGGAGCAGAGCAGGCACCCCTCTAGCTAAGCGTCTGTGGTACGTCCTAAACCGGGGCCCTCCAAGTCCCCGCGCTTCCGAGCTCCGCGCAAACTCTGGCTCTTCTTGTGCGACGGAGGTGGTTTGCTCTTCCGTTGCCCCGTGGCTTCGGCTCATCTCCAGCAGGAAGGCGAGGCTTCCGCCCGGCGCAGGGGATGTCCAGCTCGCCGCTGTCCAAGAAACGTCGCGTGTCCGGGCCTGATCCAAAGCCGGGTTCTAACTGTTCCCCCGCCCAGTCTGTGTTGTCCGAAGTGCCCTCGGTGCCAACTAACGGAATGGCGAAGAACGGCAGTGAAGCAGACATAGATGAGGGCCTTTACTCTCGGCAGCTGTACGTGTTGGGCCATGAGGCAATGAAGCGGCTCCAGACATCCAGCGTACTGGTATCAGGCCTGCGGGGCCTGGGCGTGGAGATTGCCAAAAACATCATCCTTGGTGGGGTCAAGGCTGTCACCCTACATGACCAGGGCACTGCCCAGTGGGCTGACCTCTCTTCCCAGTTCTACCTGCGGGAGGAGGACATTGGTAAAAACCGGGCAGAGGTCTCCCAGCCCCGTCTTGCTGAACTCAACAGCTACGTGCCTGTCAGCGCCTACACTGGGCCTCTTGTCGAGGACTTCCTTAGTGGCTTCCAGGTGGTGGTCCTCACCAACACCCCCCTGGAGGACCAGCTTCGGGTGGGTGAGTTCTGTCACAGCCGTGGCATCAAGCTGGTGGTGGCAGACACACGGGGCCTATTTGGACAACTCTTCTGTGACTTCGGAGAAGAAATGATTCTCACTGATTCCAATGGAGAGCAGCCACTCAGTGCTATGGTTTCTATGGTCACCAAGGACAACCCCGGTGTGGTTACCTGCCTGGATGAGGCCCGACATGGGTTTGAGAATGGCGACTTTGTCTCCTTCTCAGAAGTACAGGGCATGGTTGAACTCAACGGAAGTCAGCCCATGGAGATCAAAGTTCTGGGTCCTTACACCTTTAGCATCTGTGACACCTCTCACTTCTCTGACTATATCCGTGGTGGTATCGTCAGTCAGGTCAAAGTACCTAAGAAGATCAGCTTTAAATCTTTGCTGGCCTCACTGGCAGAGCCCAACTTCGTGATGACAGACTTTGCCAAGTTTTCCCGTCCTGCACAGCTGCACATTGGCTTCCAGGCCCTGCACCAGTTCTGTGCTCAGCACGGCCGGGCCCCTCGGCCCCGCAATGAGGAGGATGCAACAGAGCTAGTGACCTTAGCCCAGGCCATGAATGCTCGAGCCCTGCCAGCAGTGCAGCAGGACAGTCTGGATGAGGACCTCATCCGGAAGCTGGCATATGTGGCTGCTGGGGATCTGGCACCCATAAACGCCTTCATTGGGGGCCTGGCTGCCCAGGAGGTCATGAAGGCCTGCTCTGGGAAGTTTATGCCTATCATGCAGTGGCTATACTTTGATGCTCTGGAGTGTCTCCCTGAGAACAAAGAGGCCCTCACAGAGGACAAGTGCCTCCCGCGCCAGAACCGTTACGATGGGCAGGTGGCTGTATTTGGCTCAGACCTACAAGAGAAGCTGGGCAAGCAGAAATACTTCCTGGTGGGTGCAGGAGCCATTGGCTGTGAGCTGCTCAAGAACTTTGCAATGATTGGATTGGGCTGTGGAGAAGGCGGAGAAATTGTCGTCACAGACATGGACACCATTGAGAAGTCAAATCTGAACCGACAGTTTCTCTTCCGGCCCTGGGATGTTACGAAGTTAAAGTCTGACACCGCTGCTGCAGCTGTGCACCAGATGAATCCACACATCCAGGTGACAAGCCACCAGAACCGTGTGGGCCCTGACACAGAGCGCATCTATGACGATGAGTTCTTCCAAAACTTGGACGGTGTGGCCAATGCCCTGGACAATGTGGATGCTCGCATGTACATGGACCGCCGCTGCGTGTACTACCGTAAGCCGCTGCTAGAGTCAGGCACACTGGGCACCAAGGGCAACGTGCAGGTGGTGATCCCCTTCCTGACAGAGTCGTACAGCTCTAGCCAGGACCCGCCTGAGAAGTCCATCCCTATCTGCACGCTGAAGAACTTCCCCAACGCTATCGAGCACACCCTGCAGTGGGCTCGGGATGAGTTTGAAGGCCTTTTCAAGCAGCCAGCAGAAAACGTCAACCAGTACCTCACAGACCCCAAGTTTGTGGAGCGGACCCTGCGGCTGGCGGGCACCCAACCTCTGGAGGTGCTGGAGGCCGTGCAGCGCAGCCTGGTGCTGCAGCGGCCACAGACCTGGGCTGACTGTGTGACCTGGGCTTGTCACCACTGGCACACTCAGTACTCTAACAACATCCGGCAGCTGCTGCACAACTTCCCTCCTGACCAGCTCACGAGCTCAGGAGCTCCGTTTTGGTCTGGGCCCAAACGCTGTCCGCATCCGCTCACCTTTGATGTCAGCAATCCCCTGCATCTGGACTACGTGATGGCTGCCGCTAACCTGTTTGCCCAAACCTACGGGCTGACGGGCTCTCAGGACCGAGCTGCGGTGGCCGCCCTCCTACAGGCTGTTCAGGTCCCCGAGTTCACCCCTAAGTCTGGCGTCAAGATCCACGTCTCTGACCAGGAGCTGCAGAGTGCCAATGCCTCTGTTGATGACAGCCGTCTAGAGGAGCTCAAGGCCACACTGCCTAGTCCAGAAAAGCTCCCTGGATTCAAGATGTACCCCATCGACTTTGAGAAGGATGATGACAGCAACTTCCATATGGATTTCATTGTGGCTGCATCCAACCTTCGGGCAGAGAACTATGACATTCCCCCTGCAGACCGGCACAAGAGCAAGCTGATTGCAGGGAAGATCATCCCAGCCATAGCCACAAGCACAGCAGCTGTGGTTGGCCTTGTGTGTCTGGAGCTCTACAAGGTGGTGCAGGGACACCGACGGCTTGACTCCTACAAGAATGGTTTCCTCAACTTAGCCCTACCCTTTTTCGGCTTCTCTGAACCCCTTGCCGCACCCCGTCACCAGTACTATAACCAAGAGTGGACGTTGTGGGATCGCTTTGAGGTACAGGGGCTGCAGCCTAACGGTGAGGAGATGACCCTCAAACAGTTCCTTGACTACTTTAAGACAGAGCATAAATTGGAGATCACCATGCTGTCCCAGGGTGTGTCCATGCTTTACTCCTTTTTCATGCCAGCTGCCAAGCTCAAGGAACGATTGGATCAGCCGATGACAGAGATCGTAAGCCGTGTGTCGAAGCGAAAGCTGGGCCGCCATGTGCGGGCGCTGGTGCTTGAGCTGTGCTGCAACGACGAGAGCGGCGAGGACGTCGAGGTCCCCTACGTACGATACACCATCCGCTGACCCCCAGCCCCTCCTGTAGACTGGCCCCAGGCCCCCTCTCCAAACCCCTTCCAGCCCAGGGCTCCCAGTTGACCTCTGGCAGTGGCCCAGCTAGCCAAGCCTGGTGTTCCCTCTTCATCCCCCTACTTGAACCCCTCTTGCCGCTGCTTCCTACCTTGTTCAGAACCTGAATCCTAATAAAGAGTTATTAACCCAGATGTGGCATGCCCAGCTGGTTCCAGGGAAGAAAGGGACTTCCTGGAGCTGTATGGTTCAGATGGTAACCCAAAGGGCTCAGCCCTACCCCAACTGCCAGTTTCCTGGGCAGAGAAAATGTGGAAATGGCTACCTTCTTCCTCTTTTCCTCCCTGCCTAGGAAGAAGTGGAGGCACCAGTGAGGCCATAGGGAGCAGGTACCTGGGTCCAATTTATATGAGCTGGGTTTCAGTTCTATCTTCTCCATTGCCTAACTCTCTGCCATGTTGATGTTGGGTCAGTGTGGCTTATGTTCTTGGGGCAGATCCCTTTTCGCCTAGCTCAAAGCACTCAGACGCCGCACAAGCCTTTACTATCATGGTTCCCAGTGCCAGGAATGCTTGTAATGCCCTTAGTTCAACTTCCCTGCTGCAGGAGAGACCTCAATGGCTCTGTTGGACTGAGGAATGCCAGTGCCTGTGTATACTTAGTTTTTAAAAATATTTGGCTGAGAGCATCTGTAGAGGAAAAGCCCCTTTCCCACCCCACTCTGCCCGCCTAGGGCCTGATCTGCCTGTCCCAAGGCCTCATACATTTGAGAAGAGAGGTAGCTGTGGAGGCTGAGGGTTGTCGATTGGTCCGAGCAGGCAGTAGGAGCTTCACTTGAGGCCCTACCAGGACTGTACGCTCCATCTGTGGTCTTGGCTGGGCACTCCAGACATTTGAAAGCACCAGTCTGGCCACCTGGTACCTAAGAATTGCACTCATACCTCTATCCCTCACCCAACCACTTAGGAACAGATTCCTTATCCCTTTGCTCAAACCTGGGTATTGGGAATAGCACAACCTGTCCCTGAACCTAGCCTGACATCCATCACAGTGTGTTCCCACATCCTCTGCCTCCTGGGCCAGCTTCAGACCCCAGGTACCATGTATGCCCTTGCCCATCTCCCTCTCATGATTACTTTTTTTTCTTGGGTGACCTCATGCTTTCACACTTCTTTTTACTCCCCACCAGGATACTGGCGACTGAGGTACTTTACCTCTGGCATCTAGTTAGTGGTGATGCTAGCTGTCTAGGTCAAGTGGAGATTTTCCTACCACAAGCACTTTTTCCATATTGCTGTTTTGGAGTACTCCAAACACTCCACACCTCTGTCTACTGTCTCCACTGTTGCAGCATCTGAGGCTGCACAAATTTATTTCTTCTGTCCCCTTTCTCCACTATCCCAGCTCCTTCTTGGATATTCTAGATACTTTGTTCACTGGATCTTCCTCATTACAGCTCCTGATTCTCCAGACGCTTCTGTCCCTTATTTCAGCACCACAGCTCTTGATTCCCCTTGCTACTTTATTTGTACCTGACACATTTCATCAAGAACTCATGAATCCTGCTTGCATCTTATTTCCCCAATACGTGCCATTTTACTTCTCATGTTTGTCTACCTTATAACACCAGCAAGATGGACTAGGGTTCAGTGGGCAGGGGTTGGGTGACTGCACTGAGAGCCCCCTGCACCCAGCAGGTACAAAACACAGGTGGGACAAGGTCGTGTCCTCTTGTTTCTGCCTACAATTATTT