Transcript asmbl_32109

Sequence
Transcript Sequence for observation asmbl_32109 of TGE0007905:
AGCAACAGCAGCAGCAGCAGCAGCCTCGCCCTCCTCCTCGCCAGCAGGAAAGAGCCCACTTGGAGAGTCTGGGGCTCAGTAGGCCTAGTCCCCAGCTGTTGGCAGAAACCCCTGTGCCTGGCCTCCCTGAGTTCCCACGGGCAGCCTCCCAGCAGGAGATCGAGCAGTCCATCGAAACCCTCAACATGCTGATGCTGGACCTGGAGCCAGCTGCGGCTGCCGCCCCCCTGCACAAATCCCAGAGTGTCCCAGGGGCCTGGCCAGGGGCCTCCCCGCTCTCTTCCCAGCCCTTCTCCGGCTCCTCCTGCCAGTCCCATCCGCTGACCCAGTCCAGATCTGGCTACATCCCCAGTGGGCATTCCTTGGGAACCCCTGAGCCAGCTCCACAGGCCTCCCTGGAGTCCGTCCCTCCTGGCAGGCCTTACTCACCTTATGATTATCAGCCATGTCCGGCTGGGCCCAACCAGAGCTACCGTCCAAAGAGCCCAGCTTCCTCCTCCACGTCCTCTGCCTTCCTTCCAACCACTCACAGCCCTTCAGGGCCTCAGCAGCCTCCGGCATCTCTCCCTGGCCTCACCGCTCAGCCTCAGCTCTCACCAAAGGAAGCGACTTCAGATCCATCCCGAACTCCGGAGGAGGAACCCTTGAACTTGGAGGGGCTAGTGGCCCACCGGGTAGCAGGGGTGCAGGCTCGGGAGAAGCAGCCTGCAGAGCCCCCGGCCCCTCTCCGGAGGCGGGCGGCCAGTGATGGACAGTATGAGAACCAGTCTTCAGAACCCTCATCTCCCCGGAGCCCTGGGGTTCGCTCCCCTGTCCAGTGCGTCTCCCCAGAGCTGGCTCTCACCATCGCTCTTAATCCTGGAGGACGGCCCAAAGAGCCCCATCTGCACAGCTACAAGGAGGCTTTTGAGGAGATGGAGGGAACCTCTCCGACCAGCCCACCGCCCAGTGGGGTGCGCTCCCCTCCAGGTCTGGCCAAGACACCCCTGTCTGCTCTGGGCCTGAAACCCCACAACCCAGCGGACATCCTGTTGCACCCCACAGGTGAGCCTCGGAGCTACGTCGAGTCGGTGGTGCGGACGGCAGTAGCTGGGCCCCGAGCTCAGGACCCTGAGCCCAAGAGCTTTAGCGCCCCAGCTGCCCAGGCCTATGGCCATGAGACGCCCCTGAGGAATGGGACCCTGGGTGGCTCCTTTGTCTCCCCCAGCCCCCTCTCCACCAGCAGCCCCATCCTCAGCGCTGACAGCACTTCAGTGGGGAGTTTCCCGTCAGGAGAGAGCAGTGACCAGGGCCCCCGGACACCCACCCAGCCTTTGCTGGATTCCGGCTTCCGCTCCGGCAGCCTGAGCCAGCCCAGCCCTTCGGCTCAGAGAAGCTACCAGAGTTCTTCTCCTCTCCCGGCCGTGGGCAGCAGCTACAGCAGCCACGACTACTCACTGCAGCAGTTCAACTCCCCAGAAAGCCAGGCCCGGGCTCAGTTTGCTGTGCCCAGCGTCCACACGGTACCCGGGAGCCCTCAGGCACGCCAGAGGACAGTGGGCACCAATACTCCCCCTAGCCCTGGCTTTGGTCGCCGAGCCATCAACCCCAGCATGGCTGCCCCTGGCAGCCCCAGTTTGAGCCACCGCCAGGTGATGGGCCCATCAGGAGCTGGTTTCCATGGTAACACAGTTTCCAGCCCCCAGAGCAGTGCAGCGACCACTCCAGGAAGCCCCAGCCGGGGCCAGCACCCTGGGGCCCACCAGGCCTCAGGCCTCCATGGCAGTGTGGTCACCACTCCAGGGAGCCCAAGCCTGGGCCGGCACCCAGGAACCCACCAGGGCAACCTGGCCCCCAGTCTCCATGGCAACACAATAGCCAGCCCCGGAAGCCCCAGCCTGGGCCGGCACCTGGGAGGATCTGGATCTGTGGTTCCCGGAAGCCCCAGCTTAGACCGGCACGTGGCCTATGGCGGCTACTCCACCCCTGAGGACCGGAGACCCACGCTGTCCCGGCAGAGCAGTGCCTCCGGCTACCAGGCTCCCTCCACGCCCTCCTTCCCTGTGTCCTCTGCCTACTACCCTGGTCTGAGTAGCCCTGCCACCTCCCCCTCGCCGGATTCAGCAGCCTTCCGGCAAGGGAGCCCAACACCGGCCTTGCCAGAGAAGCGGAGGATGTCCATGGGAGACCGGGCGGGCAGCCTCCCCAACTATGCTACCATCAACGGGAAGGTGTCCTCCTCGCCTGTCGCCAGCGGCATGTCCAGTCCCAGTGGGAGCAGCACCGTCTCCTTCTCTCATACTCTGCCTGACTTCTCCAAGTACTCCATGCCAGACAACAGCCCTGAGACCCGGGCTAAAGTGAAATTTGTCCAGGACACTTCCAAGTATTGGTACAAGCCTGAGATCTCTAGAGAGCAGGCCATCGCACTCCTGAAGGACCAGGAACCAGGGGCCTTCATCATCCGTGACAGTCACTCCTTCCGAGGGGCCTATGGGCTGGCCATGAAGGTGTCATCTCCCCCTCCGACCATTATGCAGCAGAATAAAAAAGGGGACATGACCCATGAGCTGGTGAGACATTTCCTGATAGAGACTGGCCCTAGAGGAGTCAAGCTCAAGGGGTGCCCCAATGAGCCAAACTTTGGATCCCTCTCTGCCCTGGTCTACCAGCACTCCATCATCCCACTGGCTCTGCCCTGCAAGCTGGTCATTCCAAACCGAGATCCCACAGATGAATCGAAAGATAGCTCAGGCCCTGCCAACTCAACCACTGACCTGTTGAAGCAAGGGGCAGCCTGTAACGTGCTCTTCGTCAACTCTGTGGATATGGAGTCACTCACTGGGCCACAGGCCATCTCCAAAGCCACTTCTGAGACACTGGCTGCTGACCCCACGCCGGCTGCCACCATTGTTCACTTCAAAGTTTCTGCCCAGGGAATTACACTGACTGACAACCAGAGGAAGCTCTTCTTCAGACGACACTACCCCCTCAACACTGTCACTTTCTGTGACCTGGATCCACAGGAGAGAAAGTGGATGAAGACGGAGGGAGGGGCCCCTGCTAAGCTCTTCGGCTTTGTGGCCCGGAAGCAGGGCAGCACCACGGACAACGCCTGCCACCTCTTCGCTGAGCTTGACCCTAACCAGCCTGCTTCCGCCATTGTCAACTTTGTCTCCAAGGTCATGCTGAGTGCTGGCCAGAAGAGATGAACCCACCCCTTGCCTGGGGCCAGGGCAGTGGGGATGGGGCATGTGGGGGCGGGGAGACCCATGAATCCTGACCACCTTTAAATCCAGAAGGAGGACTTTGGGCTAATTTTGGAGAAGGAGAGAAGAAAGTGCAATGTGGGGAGAGGGAAGTGAATCGCAGAGGGGAGGGGGAGAGCGGGAGAGAAAGAAAGAAAAAGATGGAGGAGGATTACTGGGATTCCTTTGGTTAGATGGATACTACGTAACCCCAAAGCCTCCCAAACTAACCAGGTCCACCTAACTCTCCCTCACCCTCCCAGAAGACAGAGTTTCTCAAAGGAGGCAGAACGGACCTCCTTGGGGATCCATGTTTTGAGGGGAATGGAAAAGCTCTGTCTCCCTAGCCCTGCTTTGCAAGGAGAAATCAAGTTGAGAGAATCTTTTTCCGGCGATCTCTAGGGTAGATTGCCAAACCAAAAAGAGCCAGCATGGGACGTCAAGGGGCAGGACTTTTGTTTTTGAAGGTAACTCAGACCCGAGGCACCTAAGGTCTCTTTGCTCTGTCTCCGATGTATAGTTCATGTGGGTATATATGTAGGGTGTGTATATGTCCACACCCACATCCTCACACACTGATTTATATTTGCCTCTCAGCTCGCATTATAAACAGGTGTACTTGTCCGTGTCCATGCGTTTGCACACACGTGCATATCGTCCAAAGAAGGTTAGAGTTGGGGTGACACAGCAGAGGAAGGGGACATCAGCCCTTCTCCCCAGGAGCACCCAGGAATATGGGTAACAGACTCTGTCTCGGTCCCTGCACCTGCAGCCTAGTAGCCCTGGGTGCCAGCAGGAGCGGGGCCGGCCACCTGCAGCATCCCTGTTCTGCCTTGGCCAGGAGGCAGGAGCACTGATGTGAGGAGATGGGGGACACGAATGCCCATCGCCTTGGGGAAGAGATCCGTCAGCCGTGGTGGCTGCAGAGCTCCGGGCATCTCTCCTGAGGCGTGTGGCCCAGCGGTGAGGTGGCTGGGTCGCTCCTGCCAGTCCCAGGCCTCAGCCCGTCCTTGGGTGCCCCGCCCAGACCAGCCTTATCTCAGACTTGCTTATCTGCATGGTGTCTTATTGGGTGCTGGAGATTGAGCCTTCCTGCTCTGCCCTGCCCTGCTCTGTCCTGCAGGGTCCCCGTGTTGGGCTCATCCAGGGGATCCTGCTTCTAAGAGTCCTGCTCAGCGAGGCCCGGGGGAGACTCCTGTCGTCCTTGTACCCCCGTCTGCAAGTGTTTTGGGGCCCGACTTTTGCTGGGCTGTCCAGGTGACTTAGTAGAGCTCTGGGGGCTGCTACCTGTACACCACATGGCCTACCTACAATACCAAAGCCTTGCTGTTCCCCCTTCTGCCTTGGTTTCCCCAGCAGAGCCAAGCTGCTCGTGAGTGGAGGGCAGAAGGCACACATTTAGGCCAAAGGGCAGTTGGGAACCCCTCAACCTCCACCCAAGGACTCTAAGCTGGAATGGAAAGTCTACCAGGATTCCATTCTTGAGGGGTTTCTTAAGCCTCTGGGGGTCCCCTAGAGAGAGGCATTGTATTGATATATAAATATATATAATATATATGTGAGACATACTGACAGAATCTGTAAGCTAATAAAATATAAGAAAAGGTTAAAAAAAGAATAGGTAAATTGACAAGAAGTATTTATTATTTTCCCATATTGCTTTATTGCCTCCCTGGGCGTAAACCAATTCCCATCCCTCTTGATATGTTTAAGTGAAGCCTGAAATGTGGGGACCTTTTTCTTTGGAGCAATCAGGGGTCTCCTTGCCCTGGCCTTGACCTTCCCCAGACTCTGTCTGGGGCTCAGCGGGGAGGGGTGCACGTGTTCCACCCCCTTTGGCCCCCTTATTTTCTGGCAAGCCCAGGACTCAGCCATCAGCTCCCGAGATGAGAAGAGAGCTGTCTGCTTACTGCGGCTCCGGCCCCAGCGGGCCGGCGGGGGACATGCGTGTTTGTGGCTGGCTTGGGCAATGTGTGCATCTTTTGTATTTTTTTCTCCTCCGAGAAGCTGTGTCTGTGTGGGCCTTCTGTTTCAGGAGAGTGTCTATAGAGTGTCTAAAGTGGGGGCAGCCCCCACTTCCCAAAGATTGAAACCTTGTGCTTGGTGACCAGGCTCCTCCACAGTGCTCTTCCTTCTGAGGGCGTTCAAGCCAGATATCCGGAATTCCCTCTCCTCAGTCCCTCCTACCCCGACTCTCTTCCCAGGTGGGAGATATCCTGCCTCCTCCCTTTGTACATATCTTACCCTCCCACGGGACAGCCCGGGGACACTCTCCTGGTCTGGATGTCCTCGCCACACTTGAGGCCGGGTGGCGTGTGAGACCGTTCTGCGGACCCAGGCCTGGGGTCAGCCTTCTCACGTGCTTTCCCACTGCCCACCACGGCCCATCTCCCAGGCACGGCCAGAGCACCCCACCCAGGCCTGAGCTGAGTGTGACCCTTGGGGTGCCAGGAAGCTGATCGACTCACTCCCTGCTGTTGCTTTGGAAGGAGTCGATTTCCTGGAGCTTGGCCTTTCCGGAAGAATGATGGGGAAGGGCACCTCAGTCTCCACGGTAGCCCCCCACTTTGGGTCAGACACTGGTTGGGAAGACACTGTAGCCCTCCCATGTCTCACAGGTTAGGCCTGTGCACCCATGCGTGCACACACACACACACACACACGCA