Transcript asmbl_270719

Sequence
Transcript Sequence for observation asmbl_270719 of TGE0007664:
TTTTGTTTTGTTTTGTTTTGTTGTAAACCGGAAAAACAGTATCAGTAAGAAGACAATAATACTAATGGTATCTACATTGGCAAGTTGGTTTGAGGATCAGAGGAGAATATATATAATCTTTCCAAATTCTAAAGTGCTTCTTATTCTTAATGGAGCAGTTGCTCTTTGCATCACGACCAGAATTAATATGCTGGAGCATTACTACATTTTTTCACCCATGAGTAATTAATTTTGTTTTAAAAATTACCAGAGTAAAATTGACTCTTTTTCGGTGTGCATATATCTAAGAATTTTAACTTGTGTATAGATTTATGTAACTACCACCACAGTCACAGCTTTTGAGATTCTTTTTTCAAAGCGTTTCACATTCATATTGCAAAACACTTTTAAAAATAAGAAAAAGGGATTTAGATAAATGTGCTGAAGATGCAAATTAGTGAAACTGGCTTTTTTGCTCAAATCCCTGCAATCTCCAACCCCTTCAGGCCCTGGACCATTTTTGCTGTTGGCTCTGCAGGCTATCTCCTGCCACAAAAGTAATCAGAAATGGACTTGAGAGTTAGGGCCTTTCTTCACACTAAGCCCACGAGTCACAGACACAAACTTCAGCATTCCTTACTTGATCCTTTTATTACCAAATCTTAATTTCCCTAACTCTCTCTAATTGCGATTTCTCTCCAAAACGAAGAAGCCTGGAATAACCAGTACCTTCTCACCCTTTCAGAGAAATTATTTGATTGGGACAGAGGGAATACAGAGTTACTGAGAGAGCAAGGATAGGGCTTTCAGGACCCCAGACCTCTCCATTATAACAGATCCTTCAATCTGTCCCTTTCCCAACTCCATCCTCTCCACCTCCCCTGCCTGCGGGGTGCCTCCTAGGGCGTTAGACTTTAGAGCCAAGCATCTTCTCTCCATCCCAACCCCCCCGCCCCCCACCCCGTAAACTCTCCCAGTTTAAGTGACATGCACAGACACACTGTTGCCACATCTGGTGAGGAGGGCGGGTCCACTTTCCGGGTGACTCATGTCGTTACTATTTGTCTTTTGTTTCTAGGATGCTTTGGCTGCAATTTTCTTCCCTTTGTTTTTAATTTGGGAGGAGAAAAAGCTAATGAATCAAGAATGAATCTTCTCTCCACTAACCTTTTCTTTTCTTTCTTAAAGTTGGTTCTCTCTTCTCACAAGTTCCATAACTGTTAAGATGTGCGGGGGCGGGACAGGTGGGGACGCACTCTTTACACCTAAATCTGAAGTTGGCGCCTAAGGTATCACTTTGATGGTAAGACTTTTTGAAGCTTTCTTGCAGCTTGCTGGGCGTTTTGCTGCTGCCACTGGACAGTTTCAGCTCTTTTCTTTATGTTGTTGCTTCGCGCTGCTGTCCCGCCTAAATTTATCTCGTTACTCTCCTAAGTGTGAATCGGGGTGAATTCCACGAGATTCACTAGCGGATTTGTTCCTGTCCAAGGTAAATACAGTATGCAAAATGAGGAACCACCAAAAGATGCCGGGGAGGGGGAGAGAGGGATTCCCTCACCTTTTCCGGCACATTCCTCGTCAATTTCCACCAGGAGGAGGCGCGCAGCGCTGATCCCCTCCAGTCTCCTTTCTCAAATCTCCCTGCGGAGGGCTGTCAAGGTTGGCCGCGCGGCAGAAGTCCCTCTGGCCGGCCTAACCCTCCCCTGCCCCCAGGTTGGTTTTTCCCAGCTGCGGAGGTTGGGCCAGGGGCTGGGGTACTAGGAGAGTCAGCGACCGCCGCGCGGAGCTGGAAAGTCGCCGCGACTCCGGTGGGACTCGGAGTTGTCTCTGGAGGTGGCGGGCGCGGAGGTGAGCGGTTGGGAGCTAGCGGCGCAGGCGAGAATCGGGAGGCGGCGCCGGGGCCCCTCCCATCCTCTGGCGGGAGAGTAACCTAGGTCCCGGGTTTCACCGCTGCTTTGTTCGCGGCCTCTTCCCTCCCATTTGGAGATGACTGGAACCCCCTCTGGGATCCGAGGAGCAGGCGAAGGCTCGGGCTGGGGTGGGGGTGGGGTGTCATCTGCTGTAGGGTCCTTTGCTTTCTGTTAATCCGAGAGGGTACAAAAAGACATGAGAAGACGCTTGTAACCTGAAACTTCCCTCTCATCCATCTGGACCTGGAGGAGAGGTCCGGGCGGGGGCGCAGACCCGGAAGGCTGGTCGTCAGCGGAGGCGGTGAGGGAAGGAGCTGGGAGAGTGAGAAGTTTGGTCGGGAAGGCGCTGGGGATTAAGCAATAAGTTAGACGCGGGGGACGAGTCTGATAACGAAAGGAGGGCGGAAGGTTGGAGAGGTACATATAGTGTGGGCCAAGGCGGAAGGAAGATTGCGCTCCTGTCTTGGGGCGCGCGCCTCTCTCCCGGGTAAGGATGTGCGTGGGACTGGGCGCGGGGGGGCGGGGGTAGGGTTGAGGGAGCGATGCCCGAACGGGCTTTCGGAGGGAGATCTTGGGGACTGAGTGCGGACGACTTGGCTTGGCTAGGCCGGTTTCCGTACTCGGGGAGCTGCGGCCGCTGCCGCTCCTCACGGTTCTCTCCCGCTTGTCCCAGGTCCTGCAGCGGATCCAGCGCAAGGCGCCAACAAAAGAGGCGAGGAGGTGGCAACCCGGGGGCGGCGGCAGGAAGAGGAGCGGGAGTTGAGTGTCCACACCCGCTGTGCGTACTTTCTAGAGGGAAGGGGCGGGGGAATCGGCCCTGGGAGGAGGACATCCGGTGGTCAAGGGGTTAGCCAAGTTCTGGTTGCTGAGCCCTCCCACGAGAGGAAAGTTTTCTCTAGACACCTCCGGCCGACCCGCGCTCTCCGGGCCCAGCTCCCGAGCCTTCGGAGCGGGCTCTGTCCCAGCCCAGCTCCGGGGAGACCCGTGCCGTGATGCCTGGGGGGTGCTCCTGGGGCCCCGCCGCCGGGGACGCTCGGCTGTGGCTGGCGGTGGTCCTCCTGGGCTGGGTCACCTCGTCCTCACTCACCTCCTCGGCGACGTCCTCCACCTCCTCCGCGCAGTTCCTGGCCTCCGCGGTGTCCGCACAGCCCCCGCTGCCAGGCCAGTGCCCCCCGCCATGCGAGTGCTCCGAGGCGGCGCGCACCGTCAAGTGCGTTAACCGCAACCTGACCGAGGTGCCAGCGGACTTGCCCCCTTATGTGCGCAACCTCTTCCTCACCGGCGATCAGCTGGCGGTGCTCCCTGCCGGCGCCTTCGCCCGCAGACCGCCGCTGGACGAGCTGACCGCGCTCAACCTCAGCGGCAGCCGCCTAAAGGAGGTGCACGCTGGCGCCTTCGAGCAACTGCCCAGCTTGCGCCAGCTCGACCTTAGCCACAACCCGCTGGACGACCTCAGCCCCTTCGCTTTCTCGGGCAGAAACGCCAGCGCCTCTGCCCCCAGCCCTCTGGTGGAACTGTTCCTGAACCACATCCTGCCTCCTGAGTTCGATCGAGAGAACCGTAGCTTCGAAGGTATGGTGGCAGCGGCCCTGCGAGCTGGCCAGGCTCTGCGCGGGCTCCACCGCCTGGAGCTGACCAGCAACCACTTGCTCTATCTGCCCCGCGACGTACTGGCACAAATGCCGGCCCTTAGGCACCTGGACCTGCGTAACAACTCGTTGGTGAGCCTGACTTATGTGTCCTTCCGCAACCTGACACACCTAGAAAGCCTCCACCTGGAGGACAACTCCCTCAAGGTCCTTCATAACGGCACCCTGGCAGAGTTGCAGGGCCTGCCCCAAGTCAGGGTCTTTCTGGACAACAATCCCTGGGTATGCGACTGCCACATGGTGGACATGGTGGCCTGGCTCAAGGAGACAGAGGTCGTGCAGGGCAAAGCTAGGCTCACCTGTGCATTCCCTGAAAAAATGAGGAATCGGGTCCTCTTGGAACTCAACAGCTCAGACCTGGACTGTGATCCTATCCTCCCTCCATCCCTGCAGACTTCTTATGTCTTCCTAGGTATTGTTTTAGCCCTGATAGGCGCGATTTTCCTACTGGTTTTGTATTTGAACCGCAAGGGGATAAAAAAGTGGATGCATAACATCAGAGATGCCTGCAGGGATCACATGGAAGGGTATCATTACAGATATGAAATCAATGCGGACCCCAGGTTAACAAACCTCAGTTCTAATTCGGATGTCTGAGAGACAATCGAGGACAAAACAAGGACAGCTATGCATGAGATGTAGACTTAAGCTTTATCTCATCCTATGCTTGCTCCATCTCCACTATCCACTATAGACACCACTGACCTTGACTGAAAGCAGTGAAGGGACTTTCCTTCCTTGTCATGTAAAGTTTTTTGGTGTGTTCTATTACTGTAAGATGATAAACAATTGCATAGTCTTTTACCTTCTTCCTTTTCTTGGAACTCCTTAATACAGGTGGAGGGATTTTTCAAGTTTCAGCATGAACATGGACTCCTGGCTGTCTGTTTCTCTTAGCACACACAGTTCAAGGTGTAGCAAGTGTACCCACACAGACAGCATTCAACAAAAGCTGCCTCAACTTTTTTGAGAAAAATACTCTATTCTTAAGTATCAGTTTTATTCTCATGTACCTAAATTGTGGAGAAAATGATTGCATTCCATAAACTGCCTGCAGACCTTAGCAAGCTCTTCAAAGTAACTCCATAGTACACTGGAGCACCTGCATCCGAGAGCATGCTTACATTTTACTGTTCTGCATATTACAAAAAAATAACTTGCAACTTCAGATAACTTCTTTGACTAAGTAAATTACATTTTTGACTGCAGTTTATATGAAACTATATGGAAGGTTTTTTTATAAACTGCATCGAGATCCAAAAGGCTAAATTGTTTTAAAAGAAATCAATAAAGATTCCTAAAAGAATTACAGTTGTGTTCAAGTTTGATATTTGAAAAAAGGATGAGGGACAATGATATTGAAGGGTCTTGGTTCCAGTGATAATTAAGGTATTAGTTATAGCTGAGCATGAAACTGGAACAATATCATATAAATAGACTTCAGAGATAATTTCGAGATGGTGGATCCTTTCAGGATTTAGAAATTTTGAATATTTATGTGAATAGACTTCTTGTGGTCCCAAAGTTAATGCTATTCAAGAAACAATTTTGTGAGAGCATTACAAAGTTGGTAAGAGGGAAGAATTCTATATGATAAACAGTTCACAGTTTGGGGCTTTTTCTAGACTAAGTTTTTAGGATAGAACAAAATTATTTACTTAAACTCTCCATATGAAATTGTTCTATAGGTGTTTAGAGTATACAACAAATATGGTGCAAATAAATGTATGAAAATTAAGTGTCTTAAAGGTAGAATATACTAAAAGATTTTAAAATATAAAGTTTTCCTAAGATCATAATACAAATTGAAACAGACTTTCTTGAGAATATTTTTTTTAAAAAAATGGAACATACACAGTGGATAGTTTATCAGAGACCCTGCTAATATGTTTAAAAAATTGTAATGATGGGGTAGGAGTTTGAGGAAATAACCGGAGATAAATGTATGTGTTCATAAACAAGTGTCTCGACTAATCATAGTTTCTTATGTTTAGTTCAGTATTTATAAATATGAGGATATTTTGATTTAGATAAGCTATATGTTGGTATATACACCTTTGTGAGGAATAAAATCCCATTTAGGTTTAAATAAAAGCAATCGGTTAATCAATTGATATTCTCTGAGTTAAATTCAGAAGTGTTCAAAATAGGGCTAAAATCATGATATCTGTTCTTTCTGTAGACTACACAGTCAGAATATGAATTTTAACTATATTAACTTTCATAAGGTTTATTTTATAAAATGTAACATTTGTTATTTATGGTTATACTTCAGATCCTATGAAAAAGTTAAATATATGGTACTTAACATTCCGTTAAACGTTTTAAGTGTTCATCAGGAATTCATAAACTGGCTGCTTGCCATTATTTCCAAAGAATGATAAAGATATGAGCGTGCCAAAAATAGTGAAAACATATAATAAGAGCACACACATGTTAGGAATAAACTGCTGATGGACTTTAGTAAGTCTGCTGATATTGTAGAAAACAAATTGTAATATTTGTAGTCGCTATTCAGAAGAATTATTTTTCCATCATGTGATAATCTAACAGTTAAAAACTGAGCTTTATGCTAGATCCAGGAAAGCAGTAGTTTCATTAGTCTAGCTTTTCTCATCATCAACTCACTGAAGCAGAATCTGATGAAGTGAAGCCAAGTTTTCATCTGTTAGGTGGATGGCTTTTTTTAAGTTATAATTTCTTGCTTCTTTTTCATTCCCTTGCTTCTTTCTCTGTATGAACTTCCGAATATGCCACTGCTCTCTTTTCTATCATATCACTCCTTGCTATTTTCTAGTACATGGCAATAGAACATTCTTAAGGTAAAAAATATTACTGTTTGAAAACAATTGGTATTGTGCAGTCATAATACTCTAAGTCTATAAGCTTATAAGGCATTTTGAGTTCCTTGGAAGATAGGAGCTATATAAACCCAGTAAGTACAAGGGAATATAAGAAAAATGAAATTAAAAGTATCATTTTAAGTGTACTTGTATTAAGCACTGTTCTTTAGTACCATTATGCATTATTGATCCTAGAAACCTACAAGTAATCCATTTTAAAAAATTTATTTTGGTTGATAATACACTATTACTCAGCTTAGCAAAGGTTTCAGAGAAAACACCATTTATCCTTTACAAGTTTCATCTGAAGAAAGTTAGAAGAATATAGGTTTCCCCCGCCATCTGAAAGTAGAGTATTCTAATGAAAACTTCTGAAGGCTGAAATGATGTAAAGTGAAGAAGCAATTACCATTAGTTTAAAAGCAAAAATCTTCTTCAAATTTCTTTTGGTTAGTGGAAAACAGGTACTAAAGCTGGTCTTTTGTAAAAGTCAAGTGGCCTAACTCAAACTTTCAAAAAGCATGGAATACCTGTACTTAAAAACTTAAGCACTTGATAAATCTTTCAATTTAAAAAGCTATTAACATGTCCAAAAAATCTTAACTTAGTGGCAAGATTTTAGGATAATATGGCTATTTGCCCCTGGATTGTAAAACTCCACTTTCAATGTAACCATTCAGTTTGCAGCATTTAATATATGTATTGACAGTTTTGCTGTCTCATGTAATTATGGTGACCTATAAGGCACATTTGTTATCTTATAGCCGATAGGTTTTTCTTACAAAATAAGTAGACTTTGAAGCGTATTTGCTAAAATTTTTTAAAGAAAAAGGAGCCACAAAAATTGATACTATCAATAAAAGACAAGATTTTTTTTTCAAAGGCAAAGAAAGTCTTCATGGAAATAAATGAGCAAATCACAAATGGTAAATCCTTTTAAAATATCTTGAATGGCAGCAAATGTGGATCATGCACACCTTAATATTTAAATAGAAATAACTTACATCTTTGTTTTCTGTCTGTTTAATTAAAGTGGATGTAAAAAAGAAAGGTCCAAATGAACTGATTGTTTCCTTAGGATTCTGTTTTCTTCTGTCCCTTCTGGTCTAATGTTCCAATACTGTGCTTAACATTCTTGAGGACATTAGAGGCTTTACAGCTCTAGTTTGGGGCTCCTTTGTATCATTTCTATTTTCCATTTAAAATCTTCCCTAAAGTCTACACAAAAAGACACCATGAGGATGTACAAGGTTAAAAACAGTTAGATATATGCTTTATTCCTGCCCCCAAATCCATTAAATTATCCAGTTTTCAGAGAGCAGCATCATAAAGTGAAGACAAATATTTATTAGATGAGATTCACGTTTCACTTCTACACTTGTGCAAGGATTTTTCACAGTAAAGGAGAGGGAAAGAAGGAAATTATATTTCTAGTAATATATGAAAAATACTTTGACAATGTCTTTAAACTCTTTCAGTAAAACTGTAATTCTACACTTGAAATAATTAGTTTAAGAAAATATATTCTGTATTGTGCAGGCGATCTTGTCTTCTAAATGGAGAAAAACAGCTCTTGGAGGATGTTTTGTACAGCTATTTTTCTGTTCTTATCCTTAGAAACATTTGACTCAAAAATGCAGGCTGCTTTTATTTTGTATTTTATCTTAAAACATTTTAGCAGCTCTAAATCTTTAGTGTCATGGGTTAAAAATATCTATATTTAAAAAAATATTTAATATACGATTCATATAATTTTTACAAAAAAACCACGAATTCTTAGTATTTCAAAATTGGAAGGGCTCTTAGATGTGTCAAGCCCAGTTTCCCATTCTACAAATGAAGAAATTGTTAATTGTAACATATCATATATAACGACAACCAGGACTAGATCTCAGGATTCCAGACTCCGCCTCTAGTGCTCTTTCTTTTCCACATGATGGCATTATTAATAACCTACCTTGAGACCTTTGAAATTCCCATGTTTAATAAAAAGAGGCAATTGCCATGGTTTTGTTTTTGCTTTGCTCTCATTCAGTTTCAGTTGGCTCTAAATTTTATAGTATGCTTCAGATCCCTGAATATGCTTAAATATGTTTGAAATGACTTTGTCATAGCAATCTTATTATGAAGCTCCTCTGAGTCTATAATATGATAGAAAATATTTTGGTAGTTTAATGGTGATAATTCTTTTGAAAAGAAAAATAAAACTCTGGAAAGTTGTGCTAGCTTGTGTAATTCTATCTTAAAAAATGAGTTAGCTCAGCTGGTGAGAACACTAAACAAATGAGACCAAGTTCATGGCCACAAAGTCAGTCATTCCGTCACCAGGTGAGACAGTCAGCTTTGCATGCTCTGCTCTGCCCTCTAAGGCCACACCCACTCCAGGTGCATTGCTATAACCCATCCTCTGAGGGCCTAGACCAAACGGAATCTAAATCAATGCAAAACTATTATCACTCTGGAAAACCAGTGGACTTACCAGCCAAACCTTGGCAGCACAGCTGCTGATGGGCCCGTTCACTTTCTTTACATATATGTAGGACCAAACATGGCAGTCTCTATATCCTCAAATTATAGTATGTATGCCACAGATCACAAAAGTTTTCTCATTTATGTGAATTTTGAGAAAAACCTATGATCAGTATCTTTTAATGTATTACACAGGAAATTAGGTTTGCTTTGCTACTTGAAAATGTGGTTTAAGATTAAAGATAATGATTACTATATCACAAACTTGTATGTAAATGTTCATAAGAACAGGAATGCAGTTTATGTTTAGCTGACATTTTATGATAATAGGGGTTATTTGTGGTTCACAGTTTAATTGTAAGGATACAATTGTTTTCAAGGAAGCAAAAGCTTAAAATATGGCCAGCTATAATAGTTTTTTTGACAAGCAAATATTTAATAATATGTTTTAAAGAACCTGAGGATGCCATCAAGATAGGCTTATTTTAAAATAGAAATTTATAGATTTCCCTACTCCCTTACTCCCATCCCCACAATCTTATTTCTACTACTTTTTGTTTTTTTCCCCCAAAGAGAACCACGATACATAACATTTCAAGGTGACTGCTTGCACACTGGAGAATTAGACTGACTAAAATATTAGGTGGGTCAGTGTACAAATATACATTTCTCTACATGAAGCAGTTTCTCTCAGTTTTACAATACAGTTAGCCAACTGTTAGAAGACTCTATCTTTCAATTAGACACGTTCTGTGGTTATTCTTACAGATCATGGAAAACACAGCTATAAAACTTTTAAAAGACATTTTAAAATTAACTCATGTTTCTTGTAGATTATTTAAAAACACAGGGTTGGGTGGACACCATGAATAGTCTTACCGCTAAGGAAAAAGTGCCTTAATATTGAGATAAACCACCATCTGTTTAAATCACATTGTATCTTGCCTTTTCACTTACAATGCTGAGAACATTCTCCAGTATCATTAAAAACTTTTAATATCTGGTTTTAAAGTACTGCAGACAATCACATATTTTACACATATAGGGTGTTTCTTACAATTTTACCTAATGTTCTAATACCTGTGTTTCTGTATCTCTCATTTTCTCCTTAAAGTAGATCTTTGAAGGAGAATTACTGCATCAGAGGGTATAATCTATTTTCTAACCTCTATTTAAATTAGGAATATTAAATGTACATCATCAGTTAACTATATGTTTTAGGAGTCTCACATCATACTTTTTACAGAGTACTGAATAGTCTGTGGACAGGATCATGAACAGAAAGAAACTTTGATTAAGTTGCTAATTTACTTGTCACTGTTTTTAATTCACAGATGTCTACGCATTGTTAAAATAACAAAATTAGAGGATAGCTAACCCCATAACTCAGGAGGGAGGGAGAGAAACAGAGAGAAGTGGGGAGAGAGAGTCAGACTCAATTATGATTCACCACTGATGTTTGATTGATGACTGAAATGTACTACGTCTCATTTAATTGATTTTGAACTTGTGTAAGTAAGCCAGTATGGCTCCCTTTGAGGCTTATAGCATGTGGCCATAAAGGGAGGTGAAAGTTCCATTGAATGCCTTATTCAAGAGTCTGTGGTATGTATGTTGAGGAGTGAAATGCATGCCTTGGTTACCATCAATAATGTCTGGAATTCTGAAGAGGTTAAGAAGTGTCTTGGTGAGGCTTTTTATTTTGGCTTTAGTATGGGCAGACCTGTGTGACCTTGATTCATATTTTGGGTATCTGCGAGGCAAGAAATCCCCAGTTTTTTAGCCAAAAGAAGGTGACCTTGGAAGACTAATCTGGCAGCAATGAATGGAGAGACAGGAAACAAGTGACTTATTTCAGTAGTTAAGGTAAGAAGGTCTTTTATAGTGGTTTTTAATTCACAAATTAAAAAGTTTCCTTGGTCAAGTTTAAAGATGCTGTTACTCTTTTTCGAGTCAGTTCTTAGGACCAGTTGGTTTTAATTTCTGAATGAATGAATTGAGAAGAATGGCTGTATCCAATAACCAGAGCGTTCCCTACTCTATTCCTTCTTGTTCTCTTCCATCCTTTGATAGATGCTCTAATGAGAAATGAATTCACCAGAGAGATTGCTTGAACAAATCTGCAATCTTAATAATTTAATACTGGCTAACCGAGTTAAACATTGGATGATATTATGTTCTAATAGTCCTTACAGTAAGTTGATTACATATAGGTAAGGTAGTTTTAATTAGCTTTATACTACATGCTGCAGAGACATTTTGTATTACTTCAGGAAGTGCTTCTTATTTAAGAAGTGACATATTTCATAATTCCTTATGTCATAGTTATATACTCTAGGCCCCATTCTTAGTACTTTATTAATAAGTAATTTTTTTCTCTTAATGGGACAATGTGGTAGGAACTATTTCATAGATGAGGAAACTGAGGC