Transcript asmbl_12524

Sequence
Transcript Sequence for observation asmbl_12524 of TGE0000112:
CCGGCGGGGAGCGGCGGCCGGTTGCGAGCCGTGAGGTGCTGCAGGTAGAGCTGGACGTACACGTCTTTGCGCTGCTCCCCGGCCGGCAGCGTCACATTGTTGGCGACCAACTCACTCTTCAACTTGTCTTTTGTCAGGACCGAGGGGTCTTCCAGGAACTCCGGCATCTCGGGGATCTGCGAAGCCCCCTCCCCACAGCCTTTGCCGCCGCCGCTCACGCCGGCGCGCTTGCTCCTGGCCGGGGACCGCGCTGCCGCCTCCGAGCCTCACGGCTCCTGCCCGGGAAGAGCGCTGCGGAGCGGAACAAAAACTCGCGGACACAAAGCCAAGCCAGACCCGGACACAAAAGACCCCAGAGCCGAACTACGAACCAACTGCGGCCAAGCTGGAAGCTCGCACCAACCCCAGCCCACACACTACAGGCAGGAGGCGAGCAGCCTGCTTCGCCCAC