Transcript asmbl_269012

Sequence
Transcript Sequence for observation asmbl_269012 of TGE0007664:
TTTTGTTTTGTTTTGTTTTGTTGTAAACCGGAAAAACAGTATCAGTAAGAAGACAATAATACTAATGGTATCTACATTGGCAAGTTGGTTTGAGGATCAGAGGAGAATATATATAATCTTTCCAAATTCTAAAGTGCTTCTTATTCTTAATGGAGCAGTTGCTCTTTGCATCACGACCAGAATTAATATGCTGGAGCATTACTACATTTTTTCACCCATGAGTAATTAATTTTGTTTTAAAAATTACCAGAGTAAAATTGACTCTTTTTCGGTGTGCATATATCTAAGAATTTTAACTTGTGTATAGATTTATGTAACTACCACCACAGTCACAGCTTTTGAGATTCTTTTTTCAAAGCGTTTCACATTCATATTGCAAAACACTTTTAAAAATAAGAAAAAGGGATTTAGATAAATGTGCTGAAGATGCAAATTAGTGAAACTGGCTTTTTTGCTCAAATCCCTGCAATCTCCAACCCCTTCAGGCCCTGGACCATTTTTGCTGTTGGCTCTGCAGGCTATCTCCTGCCACAAAAGTAATCAGAAATGGACTTGAGAGTTAGGGCCTTTCTTCACACTAAGCCCACGAGTCACAGACACAAACTTCAGCATTCCTTACTTGATCCTTTTATTACCAAATCTTAATTTCCCTAACTCTCTCTAATTGCGATTTCTCTCCAAAACGAAGAAGCCTGGAATAACCAGTACCTTCTCACCCTTTCAGAGAAATTATTTGATTGGGACAGAGGGAATACAGAGTTACTGAGAGAGCAAGGATAGGGCTTTCAGGACCCCAGACCTCTCCATTATAACAGATCCTTCAATCTGTCCCTTTCCCAACTCCATCCTCTCCACCTCCCCTGCCTGCGGGGTGCCTCCTAGGGCGTTAGACTTTAGAGCCAAGCATCTTCTCTCCATCCCAACCCCCCCGCCCCCCACCCCGTAAACTCTCCCAGTTTAAGTGACATGCACAGACACACTGTTGCCACATCTGGTGAGGAGGGCGGGTCCACTTTCCGGGTGACTCATGTCGTTACTATTTGTCTTTTGTTTCTAGGATGCTTTGGCTGCAATTTTCTTCCCTTTGTTTTTAATTTGGGAGGAGAAAAAGCTAATGAATCAAGAATGAATCTTCTCTCCACTAACCTTTTCTTTTCTTTCTTAAAGTTGGTTCTCTCTTCTCACAAGTTCCATAACTGTTAAGATGTGCGGGGGCGGGACAGGTGGGGACGCACTCTTTACACCTAAATCTGAAGTTGGCGCCTAAGGTATCACTTTGATGGTAAGACTTTTTGAAGCTTTCTTGCAGCTTGCTGGGCGTTTTGCTGCTGCCACTGGACAGTTTCAGCTCTTTTCTTTATGTTGTTGCTTCGCGCTGCTGTCCCGCCTAAATTTATCTCGTTACTCTCCTAAGTGTGAATCGGGGTGAATTCCACGAGATTCACTAGCGGATTTGTTCCTGTCCAAGGTAAATACAGTATGCAAAATGAGGAACCACCAAAAGATGCCGGGGAGGGGGAGAGAGGGATTCCCTCACCTTTTCCGGCACATTCCTCGTCAATTTCCACCAGGAGGAGGCGCGCAGCGCTGATCCCCTCCAGTCTCCTTTCTCAAATCTCCCTGCGGAGGGCTGTCAAGGTTGGCCGCGCGGCAGAAGTCCCTCTGGCCGGCCTAACCCTCCCCTGCCCCCAGGTTGGTTTTTCCCAGCTGCGGAGGTTGGGCCAGGGGCTGGGGTACTAGGAGAGTCAGCGACCGCCGCGCGGAGCTGGAAAGTCGCCGCGACTCCGGTGGGACTCGGAGTTGTCTCTGGAGGTGGCGGGCGCGGAGGTGAGCGGTTGGGAGCTAGCGGCGCAGGCGAGAATCGGGAGGCGGCGCCGGGGCCCCTCCCATCCTCTGGCGGGAGAGTAACCTAGGTCCCGGGTTTCACCGCTGCTTTGTTCGCGGCCTCTTCCCTCCCATTTGGAGATGACTGGAACCCCCTCTGGGATCCGAGGAGCAGGCGAAGGCTCGGGCTGGGGTGGGGGTGGGGTGTCATCTGCTGTAGGGTCCTTTGCTTTCTGTTAATCCGAGAGGGTACAAAAAGACATGAGAAGACGCTTGTAACCTGAAACTTCCCTCTCATCCATCTGGACCTGGAGGAGAGGTCCGGGCGGGGGCGCAGACCCGGAAGGCTGGTCGTCAGCGGAGGCGGTCCTGCAGCGGATCCAGCGCAAGGCGCCAACAAAAGAGGCGAGGAGGTGGCAACCCGGGGGCGGCGGCAGGAAGAGGAGCGGGAGTTGAGTGTCCACACCCGCTGTGCGTACTTTCTAGAGGGAAGGGGCGGGGGAATCGGCCCTGGGAGGAGGACATCCGGTGGTCAAGGGGTTAGCCAAGTTCTGGTTGCTGAGCCCTCCCACGAGAGGAAAGTTTTCTCTAGACACCTCCGGCCGACCCGCGCTCTCCGGGCCCAGCTCCCGAGCCTTCGGAGCGGGCTCTGTCCCAGCCCAGCTCCGGGGAGACCCGTGCCGTGATGCCTGGGGGGTGCTCCTGGGGCCCCGCCGCCGGGGACGCTCGGCTGTGGCTGGCGGTGGTCCTCCTGGGCTGGGTCACCTCGTCCTCACTCACCTCCTCGGCGACGTCCTCCACCTCCTCCGCGCAGTTCCTGGCCTCCGCGGTGTCCGCACAGCCCCCGCTGCCAGGCCAGTGCCCCCCGCCATGCGAGTGCTCCGAGGCGGCGCGCACCGTCAAGTGCGTTAACCGCAACCTGACCGAGGTGCCAGCGGACTTGCCCCCTTATGTGCGCAACCTCTTCCTCACCGGCGATCAGCTGGCGGTGCTCCCTGCCGGCGCCTTCGCCCGCAGACCGCCGCTGGACGAGCTGACCGCGCTCAACCTCAGCGGCAGCCGCCTAAAGGAGGTGCACGCTGGCGCCTTCGAGCAACTGCCCAGCTTGCGCCAGCTCGACCTTAGCCACAACCCGCTGGACGACCTCAGCCCCTTCGCTTTCTCGGGCAGAAACGCCAGCGCCTCTGCCCCCAGCCCTCTGGTGGAACTGTTCCTGAACCACATCCTGCCTCCTGAGTTCGATCGAGAGAACCGTAGCTTCGAAGGTATGGTGGCAGCGGCCCTGCGAGCTGGCCAGGCTCTGCGCGGGCTCCACCGCCTGGAGCTGACCAGCAACCACTTGCTCTATCTGCCCCGCGACGTACTGGCACAAATGCCGGCCCTTAGGCACCTGGACCTGCGTAACAACTCGTTGGTGAGCCTGACTTATGTGTCCTTCCGCAACCTGACACACCTAGAAAGCCTCCACCTGGAGGACAACTCCCTCAAGGTCCTTCATAACGGCACCCTGGCAGAGTTGCAGGGCCTGCCCCAAGTCAGGGTCTTTCTGGACAACAATCCCTGGGTATGCGACTGCCACATGGTGGACATGGTGGCCTGGCTCAAGGAGACAGAGGTCGTGCAGGGCAAAGCTAGGCTCACCTGTGCATTCCCTGAAAAAATGAGGAATCGGGTCCTCTTGGAACTCAACAGCTCAGACCTGGACTGTGATCCTATCCTCCCTCCATCCCTGCAGACTTCTTATGTCTTCCTAGGTATTGTTTTAGCCCTGATAGGCGCGATTTTCCTACTGGTTTTGTATTTGAACCGCAAGGGGATAAAAAAGTGGATGCATAACATCAGAGATGCCTGCAGGGATCACATGGAAGGGTATCATTACAGATATGAAATCAATGCGGACCCCAGGTTAACAAACCTCAGTTCTAATTCGGATGTCTGAGAGACAATCGAGGACAAAACAAGGACAGCTATGCATGAGATGTAGACTTAAGCTTTATCTCATCCTATGCTTGCTCCATCTCCACTATCCACTATAGACACCACTGACCTTGACTGAAAGCAGTGAAGGGACTTTCCTTCCTTGTCATGTAAAGTTTTTTGGTGTGTTCTATTACTGTAAGATGATAAACAATTGCATAGTCTTTTACCTTCTTCCTTTTCTTGGAACTCCTTAATACAGGTGGAGGGATTTTTCAAGTTTCAGCATGAACATGGACTCCTGGCTGTCTGTTTCTCTTAGCACACACAGTTCAAGGTGTAGCAAGTGTACCCACACAGACAGCATTCAACAAAAGCTGCCTCAACTTTTTTGAGAAAAATACTCTATTCTTAAGTATCAGTTTTATTCTCATGTACCTAAATTGTGGAGAAAATGATTGCATTCCATAAACTGCCTGCAGACCTTAGCAAGCTCTTCAAAGTAACTCCATAGTACACTGGAGCACCTGCATCCGAGAGCATGCTTACATTTTACTGTTCTGCATATTACAAAAAAATAACTTGCAACTTCAGATAACTTCTTTGACTAAGTAAATTACATTTTTGACTGCAGTTTATATGAAACTATATGGAAGGTTTTTTTATAAACTGCATCGAGATCCAAAAGGCTAAATTGTTTTAAAAGAAATCAATAAAGATTCCTAAAAGAATTACAGTTGTGTTCAAGTTTGATATTTGAAAAAAGGATGAGGGACAATGATATTGAAGGGTCTTGGTTCCAGTGATAATTAAGGTATTAGTTATAGCTGAGCATGAAACTGGAACAATATCATATAAATAGACTTCAGAGATAATTTCGAGATGGTGGATCCTTTCAGGATTTAGAAATTTTGAATATTTATGTGAATAGACTTCTTGTGGTCCCAAAGTTAATGCTATTCAAGAAACAATTTTGTGAGAGCATTACAAAGTTGGTAAGAGGGAAGAATTCTATATGATAAACAGTTCACAGTTTGGGGCTTTTTCTAGACTAAGTTTTTAGGATAGAACAAAATTATTTACTTAAACTCTCCATATGAAATTGTTCTATAGGTGTTTAGAGTATACAACAAATATGGTGCAAATAAATGTATGAAAATTAAGTGTCTTAAAGGTAGAATATACTAAAAGATTTTAAAATATAAAGTTTTCCTAAGATCATAATACAAATTGAAACAGACTTTCTTGAGAATATTTTTTTTAAAAAAATGGAACATACACAGTGGATAGTTTATCAGAGACCCTGCTAATATGTTTAAAAAATTGTAATGATGGGGTAGGAGTTTGAGGAAATAACCGGAGATAAATGTATGTGTTCATAAACAAGTGTCTCGACTAATCATAGTTTCTTATGTTTAGTTCAGTATTTATAAATATGAGGATATTTTGATTTAGATAAGCTATATGTTGGTATATACACCTTTGTGAGGAATAAAATCCCATTTAGGTTTAAATAAAAGCAATCGGTTAATCAATTGATATTCTCTGAGTTAAATTCAGAAGTGTTCAAAATAGGGCTAAAATCATGATATCTGTTCTTTCTGTAGACTACACAGTCAGAATATGAATTTTAACTATATTAACTTTCATAAGGTTTATTTTATAAAATGTAACATTTGTTATTTATGGTTATACTTCAGATCCTATGAAAAAGTTAAATATATGGTACTTAACATTCCGTTAAACGTTTTAAGTGTTCATCAGGAATTCATAAACTGGCTGCTTGCCATTATTTCCAAAGAATGATAAAGATATGAGCGTGCCAAAAATAGTGAAAACATATAATAAGAGCACACACATGTTAGGAATAAACTGCTGATGGACTTTAGTAAGTCTGCTGATATTGTAGAAAACAAATTGTAATATTTGTAGTCGCTATTCAGAAGAATTATTTTTCCATCATGTGATAATCTAACAGTTAAAAACTGAGCTTTATGCTAGATCCAGGAAAGCAGTAGTTTCATTAGTCTAGCTTTTCTCATCATCAACTCACTGAAGCAGAATCTGATGAAGTGAAGCCAAGTTTTCATCTGTTAGGTGGATGGCTTTTTTTAAGTTATAATTTCTTGCTTCTTTTTCATTCCCTTGCTTCTTTCTCTGTATGAACTTCCGAATATGCCACTGCTCTCTTTTCTATCATATCACTCCTTGCTATTTTCTAGTACATGGCAATAGAACATTCTTAAGGTAAAAAATATTACTGTTTGAAAACAATTGGTATTGTGCAGTCATAATACTCTAAGTCTATAAGCTTATAAGGCATTTTGAGTTCCTTGGAAGATAGGAGCTATATAAACCCAGTAAGTACAAGGGAATATAAGAAAAATGAAATTAAAAGTATCATTTTAAGTGTACTTGTATTAAGCACTGTTCTTTAGTACCATTATGCATTATTGATCCTAGAAACCTACAAGTAATCCATTTTAAAAAATTTATTTTGGTTGATAATACACTATTACTCAGCTTAGCAAAGGTTTCAGAGAAAACACCATTTATCCTTTACAAGTTTCATCTGAAGAAAGTTAGAAGAATATAGGTTTCCCCCGCCATCTGAAAGTAGAGTATTCTAATGAAAACTTCTGAAGGCTGAAATGATGTAAAGTGAAGAAGCAATTACCATTAGTTTAAAAGCAAAAATCTTCTTCAAATTTCTTTTGGTTAGTGGAAAACAGGTACTAAAGCTGGTCTTTTGTAAAAGTCAAGTGGCCTAACTCAAACTTTCAAAAAGCATGGAATACCTGTACTTAAAAACTTAAGCACTTGATAAATCTTTCAATTTAAAAAGCTATTAACATGTCCAAAAAATCTTAACTTAGTGGCAAGATTTTAGGATAATATGGCTATTTGCCCCTGGATTGTAAAACTCCACTTTCAATGTAACCATTCAGTTTGCAGCATTTAATATATGTATTGACAGTTTTGCTGTCTCATGTAATTATGGTGACCTATAAGGCACATTTGTTATCTTATAGCCGATAGGTTTTTCTTACAAAATAAGTAGACTTTGAAGCGTATTTGCTAAAATTTTTTAAAGAAAAAGGAGCCACAAAAATTGATACTATCAATAAAAGACAAGATTTTTTTTTCAAAGGCAAAGAAAGTCTTCATGGAAATAAATGAGCAAATCACAAATGGTAAATCCTTTTAAAATATCTTGAATGGCAGCAAATGTGGATCATGCACACCTTAATATTTAAATAGAAATAACTTACATCTTTGTTTTCTGTCTGTTTAATTAAAGTGGATGTAAAAAAGAAAGGTCCAAATGAACTGATTGTTTCCTTAGGATTCTGTTTTCTTCTGTCCCTTCTGGTCTAATGTTCCAATACTGTGCTTAACATTCTTGAGGACATTAGAGGCTTTACAGCTCTAGTTTGGGGCTCCTTTGTATCATTTCTATTTTCCATTTAAAATCTTCCCTAAAGTCTACACAAAAAGACACCATGAGGATGTACAAGGTTAAAAACAGTTAGATATATGCTTTATTCCTGCCCCCAAATCCATTAAATTATCCAGTTTTCAGAGAGCAGCATCATAAAGTGAAGACAAATATTTATTAGATGAGATTCACGTTTCACTTCTACACTTGTGCAAGGATTTTTCACAGTAAAGGAGAGGGAAAGAAGGAAATTATATTTCTAGTAATATATGAAAAATACTTTGACAATGTCTTTAAACTCTTTCAGTAAAACTGTAATTCTACACTTGAAATAATTAGTTTAAGAAAATATATTCTGTATTGTGCAGGCGATCTTGTCTTCTAAATGGAGAAAAACAGCTCTTGGAGGATGTTTTGTACAGCTATTTTTCTGTTCTTATCCTTAGAAACATTTGACTCAAAAATGCAGGCTGCTTTTATTTTGTATTTTATCTTAAAACATTTTAGCAGCTCTAAATCTTTAGTGTCATGGGTTAAAAATATCTATATTTAAAAAAATATTTAATATACGATTCATATAATTTTTACAAAAAAACCACGAATTCTTAGTATTTCAAAATTGGAAGGGCTCTTAGATGTGTCAAGCCCAGTTTCCCATTCTACAAATGAAGAAATTGTTAATTGTAACATATCATATATAACGACAACCAGGACTAGATCTCAGGATTCCAGACTCCGCCTCTAGTGCTCTTTCTTTTCCACATGATGGCATTATTAATAACCTACCTTGAGACCTTTGAAATTCCCATGTTTAATAAAAAGAGGCAATTGCCATGGTTTTGTTTTTGCTTTGCTCTCATTCAGTTTCAGTTGGCTCTAAATTTTATAGTATGCTTCAGATCCCTGAATATGCTTAAATATGTTTGAAATGACTTTGTCATAGCAATCTTATTATGAAGCTCCTCTGAGTCTATAATATGATAGAAAATATTTTGGTAGTTTAATGGTGATAATTCTTTTGAAAAGAAAAATAAAACTCTGGAAAGTTGTGCTAGCTTGTGTAATTCTATCTTAAAAAATGAGTTAGCTCAGCTGGTGAGAACACTAAACAAATGAGACCAAGTTCATGGCCACAAAGTCAGTCATTCCGTCACCAGGTGAGACAGTCAGCTTTGCATGCTCTGCTCTGCCCTCTAAGGCCACACCCACTCCAGGTGCATTGCTATAACCCATCCTCTGAGGGCCTAGACCAAACGGAATCTAAATCAATGCAAAACTATTATCACTCTGGAAAACCAGTGGACTTACCAGCCAAACCTTGGCAGCACAGCTGCTGATGGGCCCGTTCACTTTCTTTACATATATGTAGGACCAAACATGGCAGTCTCTATATCCTCAAATTATAGTATGTATGCCACAGATCACAAAAGTTTTCTCATTTATGTGAATTTTGAGAAAAACCTATGATCAGTATCTTTTAATGTATTACACAGGAAATTAGGTTTGCTTTGCTACTTGAAAATGTGGTTTAAGATTAAAGATAATGATTACTATATCACAAACTTGTATGTAAATGTTCATAAGAACAGGAATGCAGTTTATGTTTAGCTGACATTTTATGATAATAGGGGTTATTTGTGGTTCACAGTTTAATTGTAAGGATACAATTGTTTTCAAGGAAGCAAAAGCTTAAAATATGGCCAGCTATAATAGTTTTTTTGACAAGCAAATATTTAATAATATGTTTTAAAGAACCTGAGGATGCCATCAAGATAGGCTTATTTTAAAATAGAAATTTATAGATTTCCCTACTCCCTTACTCCCATCCCCACAATCTTATTTCTACTACTTTTTGTTTTTTTCCCCCAAAGAGAACCACGATACATAACATTTCAAGGTGACTGCTTGCACACTGGAGAATTAGACTGACTAAAATATTAGGTGGGTCAGTGTACAAATATACATTTCTCTACATGAAGCAGTTTCTCTCAGTTTTACAATACAGTTAGCCAACTGTTAGAAGACTCTATCTTTCAATTAGACACGTTCTGTGGTTATTCTTACAGATCATGGAAAACACAGCTATAAAACTTTTAAAAGACATTTTAAAATTAACTCATGTTTCTTGTAGATTATTTAAAAACACAGGGTTGGGTGGACACCATGAATAGTCTTACCGCTAAGGAAAAAGTGCCTTAATATTGAGATAAACCACCATCTGTTTAAATCACATTGTATCTTGCCTTTTCACTTACAATGCTGAGAACATTCTCCAGTATCATTAAAAACTTTTAATATCTGGTTTTAAAGTACTGCAGACAATCACATATTTTACACATATAGGGTGTTTCTTACAATTTTACCTAATGTTCTAATACCTGTGTTTCTGTATCTCTCATTTTCTCCTTAAAGTAGATCTTTGAAGGAGAATTACTGCATCAGAGGGTATAATCTATTTTCTAACCTCTATTTAAATTAGGAATATTAAATGTACATCATCAGTTAACTATATGTTTTAGGAGTCTCACATCATACTTTTTACAGAGTACTGAATAGTCTGTGGACAGGATCATGAACAGAAAGAAACTTTGATTAAGTTGCTAATTTACTTGTCACTGTTTTTAATTCACAGATGTCTACGCATTGTTAAAATAACAAAATTAGAGGATAGCTAACCCCATAACTCAGGAGGGAGGGAGAGAAACAGAGAGAAGTGGGGAGAGAGAGTCAGACTCAATTATGATTCACCACTGATGTTTGATTGATGACTGAAATGTACTACGTCTCATTTAATTGATTTTGAACTTGTGTAAGTAAGCCAGTATGGCTCCCTTTGAGGCTTATAGCATGTGGCCATAAAGGGAGGTGAAAGTTCCATTGAATGCCTTATTCAAGAGTCTGTGGTATGTATGTTGAGGAGTGAAATGCATGCCTTGGTTACCATCAATAATGTCTGGAATTCTGAAGAGGTTAAGAAGTGTCTTGGTGAGGCTTTTTATTTTGGCTTTAGTATGGGCAGACCTGTGTGACCTTGATTCATATTTTGGGTATCTGCGAGGCAAGAAATCCCCAGTTTTTTAGCCAAAAGAAGGTGACCTTGGAAGACTAATCTGGCAGCAATGAATGGAGAGACAGGAAACAAGTGACTTATTTCAGTAGTTAAGGTAAGAAGGTCTTTTATAGTGGTTTTTAATTCACAAATTAAAAAGTTTCCTTGGTCAAGTTTAAAGATGCTGTTACTCTTTTTCGAGTCAGTTCTTAGGACCAGTTGGTTTTAATTTCTGAATGAATGAATTGAGAAGAATGGCTGTATCCAATAACCAGAGCGTTCCCTACTCTATTCCTTCTTGTTCTCTTCCATCCTTTGATAGATGCTCTAATGAGAAATGAATTCACCAGAGAGATTGCTTGAACAAATCTGCAATCTTAATAATTTAATACTGGCTAACCGAGTTAAACATTGGATGATATTATGTTCTAATAGTCCTTACAGTAAGTTGATTACATATAGGTAAGGTAGTTTTAATTAGCTTTATACTACATGCTGCAGAGACATTTTGTATTACTTCAGGAAGTGCTTCTTATTTAAGAAGTGACATATTTCATAATTCCTTATGTCATAGTTATATACTCTAGGCCCCATTCTTAGTACTTTATTAATAAGTAATTTTTTTCTCTTAATGGGACAATGTGGTAGGAACTATTTCATAGATGAGGAAACTGAGGC