Transcript asmbl_269008

Sequence
Transcript Sequence for observation asmbl_269008 of TGE0007664:
TTTTGTTTTGTTTTGTTTTGTTGTAAACCGGAAAAACAGTATCAGTAAGAAGACAATAATACTAATGGTATCTACATTGGCAAGTTGGTTTGAGGATCAGAGGAGAATATATATAATCTTTCCAAATTCTAAAGTGCTTCTTATTCTTAATGGAGCAGTTGCTCTTTGCATCACGACCAGAATTAATATGCTGGAGCATTACTACATTTTTTCACCCATGAGTAATTAATTTTGTTTTAAAAATTACCAGAGTAAAATTGACTCTTTTTCGGTGTGCATATATCTAAGAATTTTAACTTGTGTATAGATTTATGTAACTACCACCACAGTCACAGCTTTTGAGATTCTTTTTTCAAAGCGTTTCACATTCATATTGCAAAACACTTTTAAAAATAAGAAAAAGGGATTTAGATAAATGTGCTGAAGATGCAAATTAGTGAAACTGGCTTTTTTGCTCAAATCCCTGCAATCTCCAACCCCTTCAGGCCCTGGACCATTTTTGCTGTTGGCTCTGCAGGCTATCTCCTGCCACAAAAGTAATCAGAAATGGACTTGAGAGTTAGGGCCTTTCTTCACACTAAGCCCACGAGTCACAGACACAAACTTCAGCATTCCTTACTTGATCCTTTTATTACCAAATCTTAATTTCCCTAACTCTCTCTAATTGCGATTTCTCTCCAAAACGAAGAAGCCTGGAATAACCAGTACCTTCTCACCCTTTCAGAGAAATTATTTGATTGGGACAGAGGGAATACAGAGTTACTGAGAGAGCAAGGATAGGGCTTTCAGGACCCCAGACCTCTCCATTATAACAGATCCTTCAATCTGTCCCTTTCCCAACTCCATCCTCTCCACCTCCCCTGCCTGCGGGGTGCCTCCTAGGGCGTTAGACTTTAGAGCCAAGCATCTTCTCTCCATCCCAACCCCCCCGCCCCCCACCCCGTAAACTCTCCCAGTTTAAGTGACATGCACAGACACACTGTTGCCACATCTGGTGAGGAGGGCGGGTCCACTTTCCGGGTGACTCATGTCGTTACTATTTGTCTTTTGTTTCTAGGATGCTTTGGCTGCAATTTTCTTCCCTTTGTTTTTAATTTGGGAGGAGAAAAAGCTAATGAATCAAGAATGAATCTTCTCTCCACTAACCTTTTCTTTTCTTTCTTAAAGTTGGTTCTCTCTTCTCACAAGTTCCATAACTGTTAAGATGTGCGGGGGCGGGACAGGTGGGGACGCACTCTTTACACCTAAATCTGAAGTTGGCGCCTAAGGTATCACTTTGATGTGTGAATCGGGGTGAATTCCACGAGATTCACTAGCGGATTTGTTCCTGTCCAAGGAGGAGGCGCGCAGCGCTGATCCCCTCCAGTCTCCTTTCTCAAATCTCCCTGCGGAGGGCTGTCAAGGTTGGCCGCGCGGCAGAAGTCCCTCTGGCCGGCCTAACCCTCCCCTGCCCCCAGGTTGGTTTTTCCCAGCTGCGGAGGTTGGGCCAGGGGCTGGGGTACTAGGAGAGTCAGCGACCGCCGCGCGGAGCTGGAAAGTCGCCGCGACTCCGGTGGGACTCGGAGTTGTCTCTGGAGGTGGCGGGCGCGGAGGTGAGCGGTTGGGAGCTAGCGGCGCAGGCGAGAATCGGGAGGCGGCGCCGGGGCCCCTCCCATCCTCTGGCGGGAGAGTAACCTAGGTCCCGGGTTTCACCGCTGCTTTGTTCGCGGCCTCTTCCCTCCCATTTGGAGATGACTGGAACCCCCTCTGGGATCCGAGGAGCAGGCGAAGGCTCGGGCTGGGGTGGGGGTGGGGTGTCATCTGCTGTAGGGTCCTTTGCTTTCTGTTAATCCGAGAGGGTACAAAAAGACATGAGAAGACGCTTGTAACCTGAAACTTCCCTCTCATCCATCTGGACCTGGAGGAGAGGTCCGGGCGGGGGCGCAGACCCGGAAGGCTGGTCGTCAGCGGAGGCGGTGAGGGAAGGAGCTGGGAGAGTGAGAAGTTTGGTCGGGAAGGCGCTGGGGATTAAGCAATAAGTTAGACGCGGGGGACGAGTCTGATAACGAAAGGAGGGCGGAAGGTTGGAGAGGTACATATAGTGTGGGCCAAGGCGGAAGGAAGATTGCGCTCCTGTCTTGGGGCGCGCGCCTCTCTCCCGGGTCCTGCAGCGGATCCAGCGCAAGGCGCCAACAAAAGAGGCGAGGAGGTGGCAACCCGGGGGCGGCGGCAGGAAGAGGAGCGGGAGTTGAGTGTCCACACCCGCTGTGCGTACTTTCTAGAGGGAAGGGGCGGGGGAATCGGCCCTGGGAGGAGGACATCCGGTGGTCAAGGGGTTAGCCAAGTTCTGGTTGCTGAGCCCTCCCACGAGAGGAAAGTTTTCTCTAGACACCTCCGGCCGACCCGCGCTCTCCGGGCCCAGCTCCCGAGCCTTCGGAGCGGGCTCTGTCCCAGCCCAGCTCCGGGGAGACCCGTGCCGTGATGCCTGGGGGGTGCTCCTGGGGCCCCGCCGCCGGGGACGCTCGGCTGTGGCTGGCGGTGGTCCTCCTGGGCTGGGTCACCTCGTCCTCACTCACCTCCTCGGCGACGTCCTCCACCTCCTCCGCGCAGTTCCTGGCCTCCGCGGTGTCCGCACAGCCCCCGCTGCCAGGCCAGTGCCCCCCGCCATGCGAGTGCTCCGAGGCGGCGCGCACCGTCAAGTGCGTTAACCGCAACCTGACCGAGGTGCCAGCGGACTTGCCCCCTTATGTGCGCAACCTCTTCCTCACCGGCGATCAGCTGGCGGTGCTCCCTGCCGGCGCCTTCGCCCGCAGACCGCCGCTGGACGAGCTGACCGCGCTCAACCTCAGCGGCAGCCGCCTAAAGGAGGTGCACGCTGGCGCCTTCGAGCAACTGCCCAGCTTGCGCCAGCTCGACCTTAGCCACAACCCGCTGGACGACCTCAGCCCCTTCGCTTTCTCGGGCAGAAACGCCAGCGCCTCTGCCCCCAGCCCTCTGGTGGAACTGTTCCTGAACCACATCCTGCCTCCTGAGTTCGATCGAGAGAACCGTAGCTTCGAAGGTATGGTGGCAGCGGCCCTGCGAGCTGGCCAGGCTCTGCGCGGGCTCCACCGCCTGGAGCTGACCAGCAACCACTTGCTCTATCTGCCCCGCGACGTACTGGCACAAATGCCGGCCCTTAGGCACCTGGACCTGCGTAACAACTCGTTGGTGAGCCTGACTTATGTGTCCTTCCGCAACCTGACACACCTAGAAAGCCTCCACCTGGAGGACAACTCCCTCAAGGTCCTTCATAACGGCACCCTGGCAGAGTTGCAGGGCCTGCCCCAAGTCAGGGTCTTTCTGGACAACAATCCCTGGGTATGCGACTGCCACATGGTGGACATGGTGGCCTGGCTCAAGGAGACAGAGGTCGTGCAGGGCAAAGCTAGGCTCACCTGTGCATTCCCTGAAAAAATGAGGAATCGGGTCCTCTTGGAACTCAACAGCTCAGACCTGGACTGTGATCCTATCCTCCCTCCATCCCTGCAGACTTCTTATGTCTTCCTAGGTATTGTTTTAGCCCTGATAGGCGCGATTTTCCTACTGGTTTTGTATTTGAACCGCAAGGGGATAAAAAAGTGGATGCATAACATCAGAGATGCCTGCAGGGATCACATGGAAGGGTATCATTACAGATATGAAATCAATGCGGACCCCAGGTTAACAAACCTCAGTTCTAATTCGGATGTCTGAGAGACAATCGAGGACAAAACAAGGACAGCTATGCATGAGATGTAGACTTAAGCTTTATCTCATCCTATGCTTGCTCCATCTCCACTATCCACTATAGACACCACTGACCTTGACTGAAAGCAGTGAAGGGACTTTCCTTCCTTGTCATGTAAAGTTTTTTGGTGTGTTCTATTACTGTAAGATGATAAACAATTGCATAGTCTTTTACCTTCTTCCTTTTCTTGGAACTCCTTAATACAGGTGGAGGGATTTTTCAAGTTTCAGCATGAACATGGACTCCTGGCTGTCTGTTTCTCTTAGCACACACAGTTCAAGGTGTAGCAAGTGTACCCACACAGACAGCATTCAACAAAAGCTGCCTCAACTTTTTTGAGAAAAATACTCTATTCTTAAGTATCAGTTTTATTCTCATGTACCTAAATTGTGGAGAAAATGATTGCATTCCATAAACTGCCTGCAGACCTTAGCAAGCTCTTCAAAGTAACTCCATAGTACACTGGAGCACCTGCATCCGAGAGCATGCTTACATTTTACTGTTCTGCATATTACAAAAAAATAACTTGCAACTTCAGATAACTTCTTTGACTAAGTAAATTACATTTTTGACTGCAGTTTATATGAAACTATATGGAAGGTTTTTTTATAAACTGCATCGAGATCCAAAAGGCTAAATTGTTTTAAAAGAAATCAATAAAGATTCCTAAAAGAATTACAGTTGTGTTCAAGTTTGATATTTGAAAAAAGGATGAGGGACAATGATATTGAAGGGTCTTGGTTCCAGTGATAATTAAGGTATTAGTTATAGCTGAGCATGAAACTGGAACAATATCATATAAATAGACTTCAGAGATAATTTCGAGATGGTGGATCCTTTCAGGATTTAGAAATTTTGAATATTTATGTGAATAGACTTCTTGTGGTCCCAAAGTTAATGCTATTCAAGAAACAATTTTGTGAGAGCATTACAAAGTTGGTAAGAGGGAAGAATTCTATATGATAAACAGTTCACAGTTTGGGGCTTTTTCTAGACTAAGTTTTTAGGATAGAACAAAATTATTTACTTAAACTCTCCATATGAAATTGTTCTATAGGTGTTTAGAGTATACAACAAATATGGTGCAAATAAATGTATGAAAATTAAGTGTCTTAAAGGTAGAATATACTAAAAGATTTTAAAATATAAAGTTTTCCTAAGATCATAATACAAATTGAAACAGACTTTCTTGAGAATATTTTTTTTAAAAAAATGGAACATACACAGTGGATAGTTTATCAGAGACCCTGCTAATATGTTTAAAAAATTGTAATGATGGGGTAGGAGTTTGAGGAAATAACCGGAGATAAATGTATGTGTTCATAAACAAGTGTCTCGACTAATCATAGTTTCTTATGTTTAGTTCAGTATTTATAAATATGAGGATATTTTGATTTAGATAAGCTATATGTTGGTATATACACCTTTGTGAGGAATAAAATCCCATTTAGGTTTAAATAAAAGCAATCGGTTAATCAATTGATATTCTCTGAGTTAAATTCAGAAGTGTTCAAAATAGGGCTAAAATCATGATATCTGTTCTTTCTGTAGACTACACAGTCAGAATATGAATTTTAACTATATTAACTTTCATAAGGTTTATTTTATAAAATGTAACATTTGTTATTTATGGTTATACTTCAGATCCTATGAAAAAGTTAAATATATGGTACTTAACATTCCGTTAAACGTTTTAAGTGTTCATCAGGAATTCATAAACTGGCTGCTTGCCATTATTTCCAAAGAATGATAAAGATATGAGCGTGCCAAAAATAGTGAAAACATATAATAAGAGCACACACATGTTAGGAATAAACTGCTGATGGACTTTAGTAAGTCTGCTGATATTGTAGAAAACAAATTGTAATATTTGTAGTCGCTATTCAGAAGAATTATTTTTCCATCATGTGATAATCTAACAGTTAAAAACTGAGCTTTATGCTAGATCCAGGAAAGCAGTAGTTTCATTAGTCTAGCTTTTCTCATCATCAACTCACTGAAGCAGAATCTGATGAAGTGAAGCCAAGTTTTCATCTGTTAGGTGGATGGCTTTTTTTAAGTTATAATTTCTTGCTTCTTTTTCATTCCCTTGCTTCTTTCTCTGTATGAACTTCCGAATATGCCACTGCTCTCTTTTCTATCATATCACTCCTTGCTATTTTCTAGTACATGGCAATAGAACATTCTTAAGGTAAAAAATATTACTGTTTGAAAACAATTGGTATTGTGCAGTCATAATACTCTAAGTCTATAAGCTTATAAGGCATTTTGAGTTCCTTGGAAGATAGGAGCTATATAAACCCAGTAAGTACAAGGGAATATAAGAAAAATGAAATTAAAAGTATCATTTTAAGTGTACTTGTATTAAGCACTGTTCTTTAGTACCATTATGCATTATTGATCCTAGAAACCTACAAGTAATCCATTTTAAAAAATTTATTTTGGTTGATAATACACTATTACTCAGCTTAGCAAAGGTTTCAGAGAAAACACCATTTATCCTTTACAAGTTTCATCTGAAGAAAGTTAGAAGAATATAGGTTTCCCCCGCCATCTGAAAGTAGAGTATTCTAATGAAAACTTCTGAAGGCTGAAATGATGTAAAGTGAAGAAGCAATTACCATTAGTTTAAAAGCAAAAATCTTCTTCAAATTTCTTTTGGTTAGTGGAAAACAGGTACTAAAGCTGGTCTTTTGTAAAAGTCAAGTGGCCTAACTCAAACTTTCAAAAAGCATGGAATACCTGTACTTAAAAACTTAAGCACTTGATAAATCTTTCAATTTAAAAAGCTATTAACATGTCCAAAAAATCTTAACTTAGTGGCAAGATTTTAGGATAATATGGCTATTTGCCCCTGGATTGTAAAACTCCACTTTCAATGTAACCATTCAGTTTGCAGCATTTAATATATGTATTGACAGTTTTGCTGTCTCATGTAATTATGGTGACCTATAAGGCACATTTGTTATCTTATAGCCGATAGGTTTTTCTTACAAAATAAGTAGACTTTGAAGCGTATTTGCTAAAATTTTTTAAAGAAAAAGGAGCCACAAAAATTGATACTATCAATAAAAGACAAGATTTTTTTTTCAAAGGCAAAGAAAGTCTTCATGGAAATAAATGAGCAAATCACAAATGGTAAATCCTTTTAAAATATCTTGAATGGCAGCAAATGTGGATCATGCACACCTTAATATTTAAATAGAAATAACTTACATCTTTGTTTTCTGTCTGTTTAATTAAAGTGGATGTAAAAAAGAAAGGTCCAAATGAACTGATTGTTTCCTTAGGATTCTGTTTTCTTCTGTCCCTTCTGGTCTAATGTTCCAATACTGTGCTTAACATTCTTGAGGACATTAGAGGCTTTACAGCTCTAGTTTGGGGCTCCTTTGTATCATTTCTATTTTCCATTTAAAATCTTCCCTAAAGTCTACACAAAAAGACACCATGAGGATGTACAAGGTTAAAAACAGTTAGATATATGCTTTATTCCTGCCCCCAAATCCATTAAATTATCCAGTTTTCAGAGAGCAGCATCATAAAGTGAAGACAAATATTTATTAGATGAGATTCACGTTTCACTTCTACACTTGTGCAAGGATTTTTCACAGTAAAGGAGAGGGAAAGAAGGAAATTATATTTCTAGTAATATATGAAAAATACTTTGACAATGTCTTTAAACTCTTTCAGTAAAACTGTAATTCTACACTTGAAATAATTAGTTTAAGAAAATATATTCTGTATTGTGCAGGCGATCTTGTCTTCTAAATGGAGAAAAACAGCTCTTGGAGGATGTTTTGTACAGCTATTTTTCTGTTCTTATCCTTAGAAACATTTGACTCAAAAATGCAGGCTGCTTTTATTTTGTATTTTATCTTAAAACATTTTAGCAGCTCTAAATCTTTAGTGTCATGGGTTAAAAATATCTATATTTAAAAAAATATTTAATATACGATTCATATAATTTTTACAAAAAAACCACGAATTCTTAGTATTTCAAAATTGGAAGGGCTCTTAGATGTGTCAAGCCCAGTTTCCCATTCTACAAATGAAGAAATTGTTAATTGTAACATATCATATATAACGACAACCAGGACTAGATCTCAGGATTCCAGACTCCGCCTCTAGTGCTCTTTCTTTTCCACATGATGGCATTATTAATAACCTACCTTGAGACCTTTGAAATTCCCATGTTTAATAAAAAGAGGCAATTGCCATGGTTTTGTTTTTGCTTTGCTCTCATTCAGTTTCAGTTGGCTCTAAATTTTATAGTATGCTTCAGATCCCTGAATATGCTTAAATATGTTTGAAATGACTTTGTCATAGCAATCTTATTATGAAGCTCCTCTGAGTCTATAATATGATAGAAAATATTTTGGTAGTTTAATGGTGATAATTCTTTTGAAAAGAAAAATAAAACTCTGGAAAGTTGTGCTAGCTTGTGTAATTCTATCTTAAAAAATGAGTTAGCTCAGCTGGTGAGAACACTAAACAAATGAGACCAAGTTCATGGCCACAAAGTCAGTCATTCCGTCACCAGGTGAGACAGTCAGCTTTGCATGCTCTGCTCTGCCCTCTAAGGCCACACCCACTCCAGGTGCATTGCTATAACCCATCCTCTGAGGGCCTAGACCAAACGGAATCTAAATCAATGCAAAACTATTATCACTCTGGAAAACCAGTGGACTTACCAGCCAAACCTTGGCAGCACAGCTGCTGATGGGCCCGTTCACTTTCTTTACATATATGTAGGACCAAACATGGCAGTCTCTATATCCTCAAATTATAGTATGTATGCCACAGATCACAAAAGTTTTCTCATTTATGTGAATTTTGAGAAAAACCTATGATCAGTATCTTTTAATGTATTACACAGGAAATTAGGTTTGCTTTGCTACTTGAAAATGTGGTTTAAGATTAAAGATAATGATTACTATATCACAAACTTGTATGTAAATGTTCATAAGAACAGGAATGCAGTTTATGTTTAGCTGACATTTTATGATAATAGGGGTTATTTGTGGTTCACAGTTTAATTGTAAGGATACAATTGTTTTCAAGGAAGCAAAAGCTTAAAATATGGCCAGCTATAATAGTTTTTTTGACAAGCAAATATTTAATAATATGTTTTAAAGAACCTGAGGATGCCATCAAGATAGGCTTATTTTAAAATAGAAATTTATAGATTTCCCTACTCCCTTACTCCCATCCCCACAATCTTATTTCTACTACTTTTTGTTTTTTTCCCCCAAAGAGAACCACGATACATAACATTTCAAGGTGACTGCTTGCACACTGGAGAATTAGACTGACTAAAATATTAGGTGGGTCAGTGTACAAATATACATTTCTCTACATGAAGCAGTTTCTCTCAGTTTTACAATACAGTTAGCCAACTGTTAGAAGACTCTATCTTTCAATTAGACACGTTCTGTGGTTATTCTTACAGATCATGGAAAACACAGCTATAAAACTTTTAAAAGACATTTTAAAATTAACTCATGTTTCTTGTAGATTATTTAAAAACACAGGGTTGGGTGGACACCATGAATAGTCTTACCGCTAAGGAAAAAGTGCCTTAATATTGAGATAAACCACCATCTGTTTAAATCACATTGTATCTTGCCTTTTCACTTACAATGCTGAGAACATTCTCCAGTATCATTAAAAACTTTTAATATCTGGTTTTAAAGTACTGCAGACAATCACATATTTTACACATATAGGGTGTTTCTTACAATTTTACCTAATGTTCTAATACCTGTGTTTCTGTATCTCTCATTTTCTCCTTAAAGTAGATCTTTGAAGGAGAATTACTGCATCAGAGGGTATAATCTATTTTCTAACCTCTATTTAAATTAGGAATATTAAATGTACATCATCAGTTAACTATATGTTTTAGGAGTCTCACATCATACTTTTTACAGAGTACTGAATAGTCTGTGGACAGGATCATGAACAGAAAGAAACTTTGATTAAGTTGCTAATTTACTTGTCACTGTTTTTAATTCACAGATGTCTACGCATTGTTAAAATAACAAAATTAGAGGATAGCTAACCCCATAACTCAGGAGGGAGGGAGAGAAACAGAGAGAAGTGGGGAGAGAGAGTCAGACTCAATTATGATTCACCACTGATGTTTGATTGATGACTGAAATGTACTACGTCTCATTTAATTGATTTTGAACTTGTGTAAGTAAGCCAGTATGGCTCCCTTTGAGGCTTATAGCATGTGGCCATAAAGGGAGGTGAAAGTTCCATTGAATGCCTTATTCAAGAGTCTGTGGTATGTATGTTGAGGAGTGAAATGCATGCCTTGGTTACCATCAATAATGTCTGGAATTCTGAAGAGGTTAAGAAGTGTCTTGGTGAGGCTTTTTATTTTGGCTTTAGTATGGGCAGACCTGTGTGACCTTGATTCATATTTTGGGTATCTGCGAGGCAAGAAATCCCCAGTTTTTTAGCCAAAAGAAGGTGACCTTGGAAGACTAATCTGGCAGCAATGAATGGAGAGACAGGAAACAAGTGACTTATTTCAGTAGTTAAGGTAAGAAGGTCTTTTATAGTGGTTTTTAATTCACAAATTAAAAAGTTTCCTTGGTCAAGTTTAAAGATGCTGTTACTCTTTTTCGAGTCAGTTCTTAGGACCAGTTGGTTTTAATTTCTGAATGAATGAATTGAGAAGAATGGCTGTATCCAATAACCAGAGCGTTCCCTACTCTATTCCTTCTTGTTCTCTTCCATCCTTTGATAGATGCTCTAATGAGAAATGAATTCACCAGAGAGATTGCTTGAACAAATCTGCAATCTTAATAATTTAATACTGGCTAACCGAGTTAAACATTGGATGATATTATGTTCTAATAGTCCTTACAGTAAGTTGATTACATATAGGTAAGGTAGTTTTAATTAGCTTTATACTACATGCTGCAGAGACATTTTGTATTACTTCAGGAAGTGCTTCTTATTTAAGAAGTGACATATTTCATAATTCCTTATGTCATAGTTATATACTCTAGGCCCCATTCTTAGTACTTTATTAATAAGTAATTTTTTTCTCTTAATGGGACAATGTGGTAGGAACTATTTCATAGATGAGGAAACTGAGGC